RchiOBHm_Chr3g0457301

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0002038
Physical Location & Seq
Forward (+)
6487012 .. 6487413
402 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ42405

Sequence Viewer

Length: 189 bp
ATGGGTGGCCTTGGTTTTCGGAATCTTAATGACTTCAATTTATCTCTTCTGGTGAAAATGTGTTGGAGAATTATTCAGCAACCTGAAGATCTTTTGGTGCAGGTTCTTAAAGGATTATATTTCGGAATAGCGATATTTTACATGCATCCAAGGGTTCTCGTGCTTCTTCGGCCTGGAGCAGTATTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-CCHC_4 zf-RVT

Protein Analysis

62

Amino Acids

7.14

Weight (kDa)

9.62

Isoelectric Point (pI)

52.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 91
AcuI CTGAAG 1 cut(s) 105
AgsI TTSAA 1 cut(s) 37
AjnI CCWGG 1 cut(s) 172
AoxI GGCC 2 cut(s) 7, 170
AsuHPI GGTGA 1 cut(s) 64
BauI CACGAG 1 cut(s) 158
BciT130I CCWGG 1 cut(s) 174
BfaI CTAG 1 cut(s) 187
BfuAI ACCTGC 1 cut(s) 91
BglII AGATCT 1 cut(s) 88
Bme1390I CCNGG 1 cut(s) 174
BmrFI CCNGG 1 cut(s) 174
BmsI GCATC 1 cut(s) 154
BsaJI CCNNGG 2 cut(s) 10, 149
BseBI CCWGG 1 cut(s) 174
BseDI CCNNGG 2 cut(s) 10, 149
BseGI GGATG 1 cut(s) 145
BsgI GTGCAG 1 cut(s) 119
BshFI GGCC 2 cut(s) 9, 172
BsnI GGCC 2 cut(s) 9, 172
Bsp143I GATC 1 cut(s) 88
BspANI GGCC 2 cut(s) 9, 172
BspMI ACCTGC 1 cut(s) 91
BssECI CCNNGG 2 cut(s) 10, 149
BssMI GATC 1 cut(s) 88
BssSI CACGAG 1 cut(s) 158
BssT1I CCWWGG 2 cut(s) 10, 149
Bst2BI CACGAG 1 cut(s) 158
Bst2UI CCWGG 1 cut(s) 174
Bst6I CTCTTC 1 cut(s) 51
BstF5I GGATG 1 cut(s) 145
BstKTI GATC 1 cut(s) 91
BstMBI GATC 1 cut(s) 88
BstMWI GCNNNNNNNGC 1 cut(s) 169
BstNI CCWGG 1 cut(s) 174
BstNSI RCATGY 1 cut(s) 145
BstSCI CCNGG 1 cut(s) 172
BstX2I RGATCY 1 cut(s) 88
BstYI RGATCY 1 cut(s) 88
BsuRI GGCC 2 cut(s) 9, 172
BtsCI GGATG 1 cut(s) 145
BveI ACCTGC 1 cut(s) 91
CviAII CATG 1 cut(s) 142
CviJI RGCY 2 cut(s) 9, 172
CviKI_1 RGCY 2 cut(s) 9, 172
DpnI GATC 1 cut(s) 90
DpnII GATC 1 cut(s) 88
Eam1104I CTCTTC 1 cut(s) 51
EarI CTCTTC 1 cut(s) 51
Eco130I CCWWGG 2 cut(s) 10, 149
Eco57I CTGAAG 1 cut(s) 105
EcoRII CCWGG 1 cut(s) 172
EcoT14I CCWWGG 2 cut(s) 10, 149
EcoT22I ATGCAT 1 cut(s) 147
ErhI CCWWGG 2 cut(s) 10, 149
FaeI CATG 1 cut(s) 145
FaiI YATR 2 cut(s) 118, 143
FatI CATG 1 cut(s) 141
FokI GGATG 1 cut(s) 132
FspBI CTAG 1 cut(s) 187
HaeIII GGCC 2 cut(s) 9, 172
Hin1II CATG 1 cut(s) 145
HinfI GANTC 1 cut(s) 22
HphI GGTGA 1 cut(s) 64
Hpy188I TCNGA 2 cut(s) 21, 125
HpyCH4V TGCA 2 cut(s) 100, 145
HpyF10VI GCNNNNNNNGC 1 cut(s) 169
Hsp92II CATG 1 cut(s) 145
Kzo9I GATC 1 cut(s) 88
LmnI GCTCC 1 cut(s) 176
LpnPI CCDG 4 cut(s) 35, 86, 96, 159
LweI GCATC 1 cut(s) 154
MaeI CTAG 1 cut(s) 187
MalI GATC 1 cut(s) 90
MboI GATC 1 cut(s) 88
MboII GAAGA 3 cut(s) 38, 98, 158
MflI RGATCY 1 cut(s) 88
MluCI AATT 2 cut(s) 37, 69
MmeI TCCRAC 1 cut(s) 44
Mph1103I ATGCAT 1 cut(s) 147
MseI TTAA 2 cut(s) 27, 108
MspR9I CCNGG 1 cut(s) 174
MvaI CCWGG 1 cut(s) 174
MwoI GCNNNNNNNGC 1 cut(s) 169
NdeII GATC 1 cut(s) 88
NlaIII CATG 1 cut(s) 145
NsiI ATGCAT 1 cut(s) 147
NspI RCATGY 1 cut(s) 145
PfeI GAWTC 1 cut(s) 22
Psp6I CCWGG 1 cut(s) 172
PspGI CCWGG 1 cut(s) 172
PsuI RGATCY 1 cut(s) 88
SaqAI TTAA 2 cut(s) 27, 108
Sau3AI GATC 1 cut(s) 88
ScrFI CCNGG 1 cut(s) 174
SetI ASST 2 cut(s) 85, 105
SfaNI GCATC 1 cut(s) 154
SgeI CNNG 9 cut(s) 23, 62, 95, 113, 154, 162, 170, 172, 185
Sse9I AATT 2 cut(s) 37, 69
SspMI CTAG 1 cut(s) 187
StyD4I CCNGG 1 cut(s) 172
StyI CCWWGG 2 cut(s) 10, 149
TasI AATT 2 cut(s) 37, 69
TfiI GAWTC 1 cut(s) 22
Tru1I TTAA 2 cut(s) 27, 108
Tru9I TTAA 2 cut(s) 27, 108
XceI RCATGY 1 cut(s) 145
XspI CTAG 1 cut(s) 187
Zsp2I ATGCAT 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.