Rmu_sc0003961.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003961.1
OG0002038
Physical Location & Seq
Forward (+)
1 .. 1931
1931 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003961.1_g000001.1.cds

Sequence Viewer

Length: 337 bp
acgtgtcacctccgacgcggcggaccgaatcctagacgacgacatcatccccctcgtgatcgtgaagaggaccttaataatcaaacttgacaactctaactcatcatccataaatacagctctattcgaaaatcttctaaagctgcaagttccattggaggagcgtagctccatagtggagaaagtaatgttcaaaggcttcgaggcggcacggaaatatagttcttatgctagtgtgaagagactgcgtatgcaggtgaacattgatttgtatgtgattgatgatgatgttgatgaggacacaaatgctggtgatgattatctatactattattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

111

Amino Acids

12.74

Weight (kDa)

4.56

Isoelectric Point (pI)

30.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 245
Acc36I ACCTGC 1 cut(s) 245
AccII CGCG 1 cut(s) 18
AciI CCGC 3 cut(s) 18, 21, 207
AflIII ACRYGT 1 cut(s) 2
AgsI TTSAA 1 cut(s) 194
AloI GAACNNNNNNTCC 2 cut(s) 206, 238
AluBI AGCT 3 cut(s) 120, 143, 169
AluI AGCT 3 cut(s) 120, 143, 169
Alw26I GTCTC 1 cut(s) 236
ApeKI GCWGC 1 cut(s) 143
Asp700I GAANNNNTTC 1 cut(s) 133
AspS9I GGNCC 2 cut(s) 23, 70
AsuHPI GGTGA 2 cut(s) 269, 324
AsuII TTCGAA 1 cut(s) 127
AvaII GGWCC 2 cut(s) 23, 70
BauI CACGAG 1 cut(s) 54
BbvI GCAGC 1 cut(s) 130
BcoDI GTCTC 1 cut(s) 236
BfaI CTAG 2 cut(s) 33, 232
BfuAI ACCTGC 1 cut(s) 245
BisI GCNGC 3 cut(s) 19, 144, 208
BlsI GCNGC 3 cut(s) 20, 145, 209
Bme18I GGWCC 2 cut(s) 23, 70
BmgT120I GGNCC 2 cut(s) 23, 70
BplI GAGNNNNNCTC 2 cut(s) 153, 185
Bpu14I TTCGAA 1 cut(s) 127
BsaBI GATNNNNATC 1 cut(s) 319
Bse8I GATNNNNATC 1 cut(s) 319
BseGI GGATG 2 cut(s) 46, 105
BseJI GATNNNNATC 1 cut(s) 319
BseRI GAGGAG 1 cut(s) 174
BseXI GCAGC 1 cut(s) 130
Bsh1236I CGCG 1 cut(s) 18
BsmAI GTCTC 1 cut(s) 236
Bsp119I TTCGAA 1 cut(s) 127
Bsp143I GATC 1 cut(s) 58
BspACI CCGC 3 cut(s) 18, 21, 207
BspFNI CGCG 1 cut(s) 18
BspMI ACCTGC 1 cut(s) 245
BspT104I TTCGAA 1 cut(s) 127
BssMI GATC 1 cut(s) 58
BssSI CACGAG 1 cut(s) 54
Bst2BI CACGAG 1 cut(s) 54
Bst6I CTCTTC 2 cut(s) 60, 234
BstBI TTCGAA 1 cut(s) 127
BstF5I GGATG 2 cut(s) 46, 105
BstFNI CGCG 1 cut(s) 18
BstKTI GATC 1 cut(s) 61
BstMAI GTCTC 1 cut(s) 236
BstMBI GATC 1 cut(s) 58
BstUI CGCG 1 cut(s) 18
BstV1I GCAGC 1 cut(s) 130
BtsCI GGATG 2 cut(s) 46, 105
BveI ACCTGC 1 cut(s) 245
Cfr13I GGNCC 2 cut(s) 23, 70
CpoI CGGWCCG 1 cut(s) 23
CseI GACGC 1 cut(s) 24
CspI CGGWCCG 1 cut(s) 23
CviJI RGCY 4 cut(s) 120, 143, 169, 199
CviKI_1 RGCY 4 cut(s) 120, 143, 169, 199
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
Eam1104I CTCTTC 2 cut(s) 60, 234
EarI CTCTTC 2 cut(s) 60, 234
EciI GGCGGA 1 cut(s) 36
Eco47I GGWCC 2 cut(s) 23, 70
EcoO109I RGGNCCY 1 cut(s) 70
FaiI YATR 7 cut(s) 111, 174, 220, 229, 252, 274, 326
FalI AAGNNNNNCTT 2 cut(s) 57, 89
Fnu4HI GCNGC 3 cut(s) 19, 144, 208
FokI GGATG 2 cut(s) 33, 92
Fsp4HI GCNGC 3 cut(s) 19, 144, 208
FspBI CTAG 2 cut(s) 33, 232
GluI GCNGC 3 cut(s) 19, 144, 208
HgaI GACGC 1 cut(s) 24
HinfI GANTC 1 cut(s) 28
HphI GGTGA 2 cut(s) 269, 324
Hpy166II GTNNAC 1 cut(s) 260
Hpy188I TCNGA 1 cut(s) 14
Hpy188III TCNNGA 2 cut(s) 56, 62
Hpy8I GTNNAC 1 cut(s) 260
Hpy99I CGWCG 2 cut(s) 18, 42
HpyCH4IV ACGT 1 cut(s) 2
HpyCH4V TGCA 2 cut(s) 146, 254
HpySE526I ACGT 1 cut(s) 2
Kzo9I GATC 1 cut(s) 58
LmnI GCTCC 2 cut(s) 161, 174
LpnPI CCDG 2 cut(s) 240, 295
Lsp1109I GCAGC 1 cut(s) 130
MaeI CTAG 2 cut(s) 33, 232
MaeII ACGT 1 cut(s) 2
MaeIII GTNAC 1 cut(s) 5
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MboII GAAGA 3 cut(s) 77, 126, 251
MmeI TCCRAC 1 cut(s) 37
MnlI CCTC 6 cut(s) 20, 61, 63, 152, 197, 290
MroXI GAANNNNTTC 1 cut(s) 133
MseI TTAA 2 cut(s) 75, 335
MvnI CGCG 1 cut(s) 18
NdeII GATC 1 cut(s) 58
NmuCI GTSAC 1 cut(s) 5
NspV TTCGAA 1 cut(s) 127
PaqCI CACCTGC 1 cut(s) 245
PdmI GAANNNNTTC 1 cut(s) 133
PfeI GAWTC 1 cut(s) 28
PkrI GCNGC 3 cut(s) 20, 145, 209
PpuMI RGGWCCY 1 cut(s) 70
Psp5II RGGWCCY 1 cut(s) 70
PspPI GGNCC 2 cut(s) 23, 70
PspPPI RGGWCCY 1 cut(s) 70
Rsr2I CGGWCCG 1 cut(s) 23
RsrII CGGWCCG 1 cut(s) 23
SaqAI TTAA 2 cut(s) 75, 335
SatI GCNGC 3 cut(s) 19, 144, 208
Sau3AI GATC 1 cut(s) 58
Sau96I GGNCC 2 cut(s) 23, 70
SetI ASST 6 cut(s) 12, 75, 122, 145, 171, 259
SfuI TTCGAA 1 cut(s) 127
SinI GGWCC 2 cut(s) 23, 70
SsiI CCGC 3 cut(s) 18, 21, 207
SspMI CTAG 2 cut(s) 33, 232
TaqI TCGA 2 cut(s) 127, 202
TaqII GACCGA 1 cut(s) 40
TauI GCSGC 2 cut(s) 21, 210
TfiI GAWTC 1 cut(s) 28
Tru1I TTAA 2 cut(s) 75, 335
Tru9I TTAA 2 cut(s) 75, 335
TseFI GTSAC 1 cut(s) 5
TseI GCWGC 1 cut(s) 143
Tsp45I GTSAC 1 cut(s) 5
TspGWI ACGGA 1 cut(s) 227
VpaK11BI GGWCC 2 cut(s) 23, 70
XmnI GAANNNNTTC 1 cut(s) 133
XspI CTAG 2 cut(s) 33, 232
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.