Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr6A

Orthogroup ID

OG0002038

Physical Location & Seq

Genomic Coordinates Reverse (-)

38983787 .. 38984789

Gene Structure 1003 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh6AG217600.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 300 bp

ATGGGTTCTACTACAGTTCTGTCACTCCTTTTGCCCTTGTCCATCTGTTTCCTCTTCAATCAATTATCCATTGTAGCAGCTGAAAATTCTTTGATACAGAAAGTAAGCCATGCCACCCCATATTATGATCTTTGTGTATCTACCCTCCGATGCGATAAAACAAGCGAAAAATCTGATACACAAGGTCTAGTATCCCTTGTGGTGAAACAAGCAGAAGCTAATGCATTAAGCACGTTCACGTACATCTTGAACCAACTGCTTACAAATGGAATGGTACTCGGATCAGCTGGTGAGTTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0004857 GO:0008150 GO:0009628 GO:0030234 GO:0043086 GO:0044092 GO:0046910 GO:0050790 GO:0050896 GO:0065007 GO:0065009 GO:0080167 GO:0098772

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PMEI

Protein Analysis

99

Amino Acids

10.61

Weight (kDa)

5.05

Isoelectric Point (pI)

15.67

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
PMEI	PF04043	31 - 84	6.6e-07	Plant invertase/pectin methylesterase inhibitor

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002038)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g14700
pyrus_communis	pycom17g02020
rosa_chinensis	RchiOBHm_Chr3g0457301
rosa_laevigata	RLG00000011732 RLG00000013316 RLG00000023211
rosa_multiflora	Rmu_sc0000435.1_g000066 Rmu_sc0000469.1_g000012 Rmu_sc0001174.1_g000016 Rmu_sc0001522.1_g000016 Rmu_sc0001605.1_g000006 Rmu_sc0002281.1_g000040 Rmu_sc0003961.1_g000001 Rmu_sc0004538.1_g000008 Rmu_sc0004849.1_g000022 Rmu_sc0006059.1_g000058 Rmu_sc0006244.1_g000015 Rmu_sc0006388.1_g000024 Rmu_sc0007199.1_g000007 Rmu_sc0009454.1_g000015 Rmu_sc0010445.1_g000010 Rmu_sc0010674.1_g000009 Rmu_sc0012734.1_g000004 Rmu_sc0016141.1_g000003 Rmu_ssc0000054.1_g000018
rosa_roxburghii	Rroxscaffold_1G00013820 Rroxscaffold_1G00019140 Rroxscaffold_2G00143180 Rroxscaffold_3G00228590 Rroxscaffold_3G00231450 Rroxscaffold_3G00272460 Rroxscaffold_4G00284560 Rroxscaffold_5G00338350 Rroxscaffold_5G00353580 Rroxscaffold_5G00357860 Rroxscaffold_5G00358350 Rroxscaffold_6G00397580 Rroxscaffold_6G00410760 Rroxscaffold_7G00170980
rosa_samantha	Rh1BG033600 Rh5AG320100 Rh6AG217600 Rh7DG178100
rosa_wichuraiana	Rw1G018200 Rw6G018990

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	289
AcsI	RAATTY	1 cut(s)	85
AfaI	GTAC	2 cut(s)	242, 276
AgsI	TTSAA	2 cut(s)	58, 250
AluBI	AGCT	3 cut(s)	80, 218, 287
AluI	AGCT	3 cut(s)	80, 218, 287
AlwI	GGATC	1 cut(s)	289
ApeKI	GCWGC	1 cut(s)	77
ApoI	RAATTY	1 cut(s)	85
AsuHPI	GGTGA	1 cut(s)	214
BbvI	GCAGC	1 cut(s)	89
BccI	CCATC	1 cut(s)	50
BciVI	GTATCC	1 cut(s)	202
BfaI	CTAG	1 cut(s)	188
BfmI	CTRYAG	1 cut(s)	12
BfuI	GTATCC	1 cut(s)	202
BisI	GCNGC	1 cut(s)	78
BlsI	GCNGC	1 cut(s)	79
BmsI	GCATC	1 cut(s)	140
BsaAI	YACGTR	1 cut(s)	240
BseXI	GCAGC	1 cut(s)	89
Bsp143I	GATC	2 cut(s)	127, 281
BspPI	GGATC	1 cut(s)	289
BssMI	GATC	2 cut(s)	127, 281
Bst4CI	ACNGT	1 cut(s)	16
Bst6I	CTCTTC	1 cut(s)	59
BstBAI	YACGTR	1 cut(s)	240
BstKTI	GATC	2 cut(s)	130, 284
BstMBI	GATC	2 cut(s)	127, 281
BstSFI	CTRYAG	1 cut(s)	12
BstV1I	GCAGC	1 cut(s)	89
BsuI	GTATCC	1 cut(s)	202
Csp6I	GTAC	2 cut(s)	241, 275
CviAII	CATG	1 cut(s)	110
CviJI	RGCY	4 cut(s)	80, 108, 218, 287
CviKI_1	RGCY	4 cut(s)	80, 108, 218, 287
CviQI	GTAC	2 cut(s)	241, 275
DpnI	GATC	2 cut(s)	129, 283
DpnII	GATC	2 cut(s)	127, 281
Eam1104I	CTCTTC	1 cut(s)	59
EarI	CTCTTC	1 cut(s)	59
EcoT22I	ATGCAT	1 cut(s)	226
FaeI	CATG	1 cut(s)	113
FaiI	YATR	3 cut(s)	111, 121, 126
FatI	CATG	1 cut(s)	109
Fnu4HI	GCNGC	1 cut(s)	78
Fsp4HI	GCNGC	1 cut(s)	78
FspBI	CTAG	1 cut(s)	188
GluI	GCNGC	1 cut(s)	78
Hin1II	CATG	1 cut(s)	113
HphI	GGTGA	1 cut(s)	214
Hpy166II	GTNNAC	1 cut(s)	237
Hpy188I	TCNGA	3 cut(s)	149, 175, 281
Hpy188III	TCNNGA	1 cut(s)	247
Hpy8I	GTNNAC	1 cut(s)	237
HpyCH4III	ACNGT	1 cut(s)	16
HpyCH4IV	ACGT	2 cut(s)	233, 239
HpyCH4V	TGCA	1 cut(s)	224
HpySE526I	ACGT	2 cut(s)	233, 239
Hsp92II	CATG	1 cut(s)	113
Kzo9I	GATC	2 cut(s)	127, 281
LpnPI	CCDG	1 cut(s)	273
Lsp1109I	GCAGC	1 cut(s)	89
LweI	GCATC	1 cut(s)	140
MaeI	CTAG	1 cut(s)	188
MaeII	ACGT	2 cut(s)	233, 239
MaeIII	GTNAC	1 cut(s)	21
MalI	GATC	2 cut(s)	129, 283
MboI	GATC	2 cut(s)	127, 281
MboII	GAAGA	1 cut(s)	46
MluCI	AATT	2 cut(s)	62, 85
MnlI	CCTC	2 cut(s)	62, 155
Mph1103I	ATGCAT	1 cut(s)	226
MseI	TTAA	1 cut(s)	227
MspA1I	CMGCKG	2 cut(s)	80, 287
NdeII	GATC	2 cut(s)	127, 281
NlaIII	CATG	1 cut(s)	113
NmuCI	GTSAC	1 cut(s)	21
NsiI	ATGCAT	1 cut(s)	226
PkrI	GCNGC	1 cut(s)	79
Ppu21I	YACGTR	1 cut(s)	240
PvuII	CAGCTG	2 cut(s)	80, 287
RsaI	GTAC	2 cut(s)	242, 276
RsaNI	GTAC	2 cut(s)	241, 275
SaqAI	TTAA	1 cut(s)	227
SatI	GCNGC	1 cut(s)	78
Sau3AI	GATC	2 cut(s)	127, 281
SetI	ASST	6 cut(s)	82, 187, 220, 236, 242, 289
SfaNI	GCATC	1 cut(s)	140
SfcI	CTRYAG	1 cut(s)	12
Sse9I	AATT	2 cut(s)	62, 85
SspMI	CTAG	1 cut(s)	188
TaaI	ACNGT	1 cut(s)	16
TaiI	ACGT	2 cut(s)	236, 242
TasI	AATT	2 cut(s)	62, 85
Tru1I	TTAA	1 cut(s)	227
Tru9I	TTAA	1 cut(s)	227
TseFI	GTSAC	1 cut(s)	21
TseI	GCWGC	1 cut(s)	77
Tsp45I	GTSAC	1 cut(s)	21
XapI	RAATTY	1 cut(s)	85
XspI	CTAG	1 cut(s)	188
Zsp2I	ATGCAT	1 cut(s)	226

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.