Basic Information

Type: gene

Biological Identity

Species

rosa_laevigata

Chromosome

Chr5

Orthogroup ID

OG0002038

Physical Location & Seq

Genomic Coordinates Forward (+)

20015334 .. 20017573

Gene Structure 2240 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

RLM00000023211

Sequence Viewer

CDS Protein Promoter (2k)

Length: 441 bp

ATGGTCTATGAGGCTATAGGATTACAGATTATTTGTGATTGGATTAGTGGGAGAGTTGTACTCTATCAGTGGCAAGTGGACAGCTTGAGCTCAGGGAAAAAAGTACCAGAAGATTTGTACCATCTGAAATTAGAATCAGACAAGTCTTCTAGTGATTACATTTCCAGTGATGAAGAAACCCCAAAACCAAAAAAGAGAAGATCCTCCTCTCCTAATGAGTTGCCTCATACTCCGAGCCCCAAAACCCCTAAAGCTCCAAGCAACGACCGAAGATCTTTTAGCTATTACAAAAGTGTAGAACAAGTTAAGGGCCTCCCTGGCATTGGAAAGTCAATGCAAGATCATATTCAAGAGATAGTGACTACTGGAAAGCTATTCAAGTTGGACCACTTTGAAATAGATAAAAAGGTAAAAACAATAAGCTTATTCGAGGAAATATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000724 GO:0000725 GO:0000726 GO:0003674 GO:0003824 GO:0003887 GO:0005488 GO:0006139 GO:0006259 GO:0006281 GO:0006284 GO:0006285 GO:0006287 GO:0006289 GO:0006302 GO:0006303 GO:0006310 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009314 GO:0009411 GO:0009416 GO:0009628 GO:0009987 GO:0010224 GO:0016740 GO:0016772 GO:0016779 GO:0016829 GO:0016835 GO:0018130 GO:0019438 GO:0030145 GO:0033554 GO:0034061 GO:0034641 GO:0034645 GO:0034654 GO:0043167 GO:0043169 GO:0043170 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044271 GO:0046483 GO:0046872 GO:0046914 GO:0050896 GO:0051575 GO:0051716 GO:0071704 GO:0071897 GO:0090304 GO:0097510 GO:0140097 GO:1901360 GO:1901362 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko03410 ko03450 map03410 map03450

Pfam Domains

Protein Families

BRCT DNA_pol_B_palm DNA_pol_B_thumb DNA_pol_lambd_f HHH_8 LIM

Protein Analysis

147

Amino Acids

16.64

Weight (kDa)

7.8

Isoelectric Point (pI)

57.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002038)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g14700
pyrus_communis	pycom17g02020
rosa_chinensis	RchiOBHm_Chr3g0457301
rosa_laevigata	RLG00000011732 RLG00000013316 RLG00000023211
rosa_multiflora	Rmu_sc0000435.1_g000066 Rmu_sc0000469.1_g000012 Rmu_sc0001174.1_g000016 Rmu_sc0001522.1_g000016 Rmu_sc0001605.1_g000006 Rmu_sc0002281.1_g000040 Rmu_sc0003961.1_g000001 Rmu_sc0004538.1_g000008 Rmu_sc0004849.1_g000022 Rmu_sc0006059.1_g000058 Rmu_sc0006244.1_g000015 Rmu_sc0006388.1_g000024 Rmu_sc0007199.1_g000007 Rmu_sc0009454.1_g000015 Rmu_sc0010445.1_g000010 Rmu_sc0010674.1_g000009 Rmu_sc0012734.1_g000004 Rmu_sc0016141.1_g000003 Rmu_ssc0000054.1_g000018
rosa_roxburghii	Rroxscaffold_1G00013820 Rroxscaffold_1G00019140 Rroxscaffold_2G00143180 Rroxscaffold_3G00228590 Rroxscaffold_3G00231450 Rroxscaffold_3G00272460 Rroxscaffold_4G00284560 Rroxscaffold_5G00338350 Rroxscaffold_5G00353580 Rroxscaffold_5G00357860 Rroxscaffold_5G00358350 Rroxscaffold_6G00397580 Rroxscaffold_6G00410760 Rroxscaffold_7G00170980
rosa_samantha	Rh1BG033600 Rh5AG320100 Rh6AG217600 Rh7DG178100
rosa_wichuraiana	Rw1G018200 Rw6G018990

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	195
AfaI	GTAC	3 cut(s)	60, 105, 119
AfiI	CCNNNNNNNGG	1 cut(s)	323
AgsI	TTSAA	3 cut(s)	350, 379, 395
AjnI	CCWGG	1 cut(s)	316
AluBI	AGCT	6 cut(s)	84, 90, 254, 282, 373, 423
AluI	AGCT	6 cut(s)	84, 90, 254, 282, 373, 423
Alw21I	GWGCWC	1 cut(s)	92
AlwI	GGATC	1 cut(s)	195
AoxI	GGCC	1 cut(s)	310
AspS9I	GGNCC	2 cut(s)	310, 385
AvaII	GGWCC	1 cut(s)	385
BanII	GRGCYC	2 cut(s)	92, 239
BbsI	GAAGAC	1 cut(s)	138
Bbv12I	GWGCWC	1 cut(s)	92
BccI	CCATC	1 cut(s)	129
BciT130I	CCWGG	1 cut(s)	318
BfaI	CTAG	1 cut(s)	150
BfmI	CTRYAG	1 cut(s)	15
BglI	GCCNNNNNGGC	1 cut(s)	318
BglII	AGATCT	1 cut(s)	272
Bme1390I	CCNGG	1 cut(s)	318
Bme18I	GGWCC	1 cut(s)	385
BmgT120I	GGNCC	2 cut(s)	310, 385
BmrFI	CCNGG	1 cut(s)	318
BpiI	GAAGAC	1 cut(s)	138
BplI	GAGNNNNNCTC	2 cut(s)	45, 77
Bpu10I	CCTNAGC	1 cut(s)	91
BpuEI	CTTGAG	1 cut(s)	106
BsaJI	CCNNGG	1 cut(s)	316
Bsc4I	CCNNNNNNNGG	1 cut(s)	323
Bse1I	ACTGG	2 cut(s)	165, 370
BseBI	CCWGG	1 cut(s)	318
BseDI	CCNNGG	1 cut(s)	316
BseLI	CCNNNNNNNGG	1 cut(s)	323
BseMII	CTCAG	1 cut(s)	105
BseNI	ACTGG	2 cut(s)	165, 370
BseRI	GAGGAG	1 cut(s)	196
Bsh1285I	CGRYCG	1 cut(s)	268
BshFI	GGCC	1 cut(s)	312
BsiEI	CGRYCG	1 cut(s)	268
BsiHKAI	GWGCWC	1 cut(s)	92
BslI	CCNNNNNNNGG	1 cut(s)	323
BsnI	GGCC	1 cut(s)	312
Bsp1286I	GDGCHC	2 cut(s)	92, 239
Bsp143I	GATC	3 cut(s)	200, 272, 340
BspANI	GGCC	1 cut(s)	312
BspCNI	CTCAG	1 cut(s)	104
BspPI	GGATC	1 cut(s)	195
BsrI	ACTGG	2 cut(s)	165, 370
BssECI	CCNNGG	1 cut(s)	316
BssMI	GATC	3 cut(s)	200, 272, 340
Bst2UI	CCWGG	1 cut(s)	318
BstDEI	CTNAG	1 cut(s)	91
BstKTI	GATC	3 cut(s)	203, 275, 343
BstMBI	GATC	3 cut(s)	200, 272, 340
BstMCI	CGRYCG	1 cut(s)	268
BstMWI	GCNNNNNNNGC	1 cut(s)	318
BstNI	CCWGG	1 cut(s)	318
BstSCI	CCNGG	1 cut(s)	316
BstSFI	CTRYAG	1 cut(s)	15
BstV2I	GAAGAC	1 cut(s)	138
BstX2I	RGATCY	2 cut(s)	200, 272
BstYI	RGATCY	2 cut(s)	200, 272
BsuRI	GGCC	1 cut(s)	312
BtsIMutI	CAGTG	2 cut(s)	74, 172
Cfr13I	GGNCC	2 cut(s)	310, 385
Csp6I	GTAC	3 cut(s)	59, 104, 118
CviJI	RGCY	9 cut(s)	14, 84, 90, 237, 254, 282, 312, 373, 423
CviKI_1	RGCY	9 cut(s)	14, 84, 90, 237, 254, 282, 312, 373, 423
CviQI	GTAC	3 cut(s)	59, 104, 118
DdeI	CTNAG	1 cut(s)	91
DpnI	GATC	3 cut(s)	202, 274, 342
DpnII	GATC	3 cut(s)	200, 272, 340
Ecl136II	GAGCTC	1 cut(s)	90
Eco24I	GRGCYC	2 cut(s)	92, 239
Eco47I	GGWCC	1 cut(s)	385
Eco53kI	GAGCTC	1 cut(s)	90
EcoICRI	GAGCTC	1 cut(s)	90
EcoO109I	RGGNCCY	1 cut(s)	310
EcoRII	CCWGG	1 cut(s)	316
EcoT38I	GRGCYC	2 cut(s)	92, 239
FaiI	YATR	5 cut(s)	9, 17, 228, 345, 439
FriOI	GRGCYC	2 cut(s)	92, 239
FspBI	CTAG	1 cut(s)	150
HaeIII	GGCC	1 cut(s)	312
HindIII	AAGCTT	1 cut(s)	421
HinfI	GANTC	1 cut(s)	134
Hpy166II	GTNNAC	1 cut(s)	79
Hpy188I	TCNGA	3 cut(s)	126, 139, 234
Hpy188III	TCNNGA	1 cut(s)	350
Hpy8I	GTNNAC	1 cut(s)	79
HpyCH4V	TGCA	1 cut(s)	337
HpyF10VI	GCNNNNNNNGC	1 cut(s)	318
HpyF3I	CTNAG	1 cut(s)	91
Kzo9I	GATC	3 cut(s)	200, 272, 340
LmnI	GCTCC	1 cut(s)	259
LpnPI	CCDG	6 cut(s)	78, 120, 178, 303, 330, 351
MaeI	CTAG	1 cut(s)	150
MaeIII	GTNAC	1 cut(s)	358
MalI	GATC	3 cut(s)	202, 274, 342
MboI	GATC	3 cut(s)	200, 272, 340
MboII	GAAGA	5 cut(s)	122, 138, 185, 210, 282
MflI	RGATCY	2 cut(s)	200, 272
MhlI	GDGCHC	2 cut(s)	92, 239
MluCI	AATT	1 cut(s)	128
MmeI	TCCRAC	1 cut(s)	363
MnlI	CCTC	6 cut(s)	4, 214, 217, 234, 323, 424
MseI	TTAA	1 cut(s)	306
MspR9I	CCNGG	1 cut(s)	318
MvaI	CCWGG	1 cut(s)	318
MwoI	GCNNNNNNNGC	1 cut(s)	318
NdeII	GATC	3 cut(s)	200, 272, 340
NmuCI	GTSAC	1 cut(s)	358
PfeI	GAWTC	1 cut(s)	134
Psp124BI	GAGCTC	1 cut(s)	92
Psp6I	CCWGG	1 cut(s)	316
PspGI	CCWGG	1 cut(s)	316
PspPI	GGNCC	2 cut(s)	310, 385
PsuI	RGATCY	2 cut(s)	200, 272
RsaI	GTAC	3 cut(s)	60, 105, 119
RsaNI	GTAC	3 cut(s)	59, 104, 118
SacI	GAGCTC	1 cut(s)	92
SaqAI	TTAA	1 cut(s)	306
Sau3AI	GATC	3 cut(s)	200, 272, 340
Sau96I	GGNCC	2 cut(s)	310, 385
ScrFI	CCNGG	1 cut(s)	318
SduI	GDGCHC	2 cut(s)	92, 239
SetI	ASST	7 cut(s)	86, 92, 256, 284, 375, 411, 425
SfcI	CTRYAG	1 cut(s)	15
SinI	GGWCC	1 cut(s)	385
SmlI	CTYRAG	1 cut(s)	85
SmoI	CTYRAG	1 cut(s)	85
Sse9I	AATT	1 cut(s)	128
SspMI	CTAG	1 cut(s)	150
SstI	GAGCTC	1 cut(s)	92
StyD4I	CCNGG	1 cut(s)	316
TaqI	TCGA	1 cut(s)	429
TaqII	GACCGA	1 cut(s)	282
TasI	AATT	1 cut(s)	128
TatI	WGTACW	1 cut(s)	58
TfiI	GAWTC	1 cut(s)	134
Tru1I	TTAA	1 cut(s)	306
Tru9I	TTAA	1 cut(s)	306
TscAI	CASTG	2 cut(s)	74, 172
TseFI	GTSAC	1 cut(s)	358
Tsp45I	GTSAC	1 cut(s)	358
TspDTI	ATGAA	1 cut(s)	186
TspRI	CASTG	2 cut(s)	74, 172
VpaK11BI	GGWCC	1 cut(s)	385
XspI	CTAG	1 cut(s)	150

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.