Rmu_sc0004849.1_g000022

ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004849.1
Physical Location & Seq
Forward (+)
116005 .. 116322
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004849.1_g000022.1.cds

Sequence Viewer

Length: 318 bp
atggccctaggatgcactggaggaattgaagttatttgggtcaagctaaacatgcaagatggtggtatgggttttcgagacttgagttccttcaatctcgcacttctagccaaacaatgttggagtttgatacaaaatcctgaatcgttttgggcgaaagtcatgaaggctacatatttctcggacaacaatttctttcaagctgaaaaaggttacaaatcttcttggagctgggcaagcttattggaggctagagatattattcttcaaggctcaaaatggcaagttatcaatggttggacagatggttacccatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.89

Weight (kDa)

6.14

Isoelectric Point (pI)

25.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 4 cut(s) 29, 94, 200, 269
AluBI AGCT 4 cut(s) 46, 203, 231, 240
AluI AGCT 4 cut(s) 46, 203, 231, 240
Alw26I GTCTC 1 cut(s) 72
AoxI GGCC 1 cut(s) 3
AspA2I CCTAGG 1 cut(s) 7
AspS9I GGNCC 1 cut(s) 4
AvrII CCTAGG 1 cut(s) 7
BccI CCATC 2 cut(s) 53, 299
BcoDI GTCTC 1 cut(s) 72
BfaI CTAG 3 cut(s) 8, 107, 252
BlnI CCTAGG 1 cut(s) 7
BmgT120I GGNCC 1 cut(s) 4
BmsI GCATC 1 cut(s) 2
BpmI CTGGAG 1 cut(s) 39
BpuEI CTTGAG 1 cut(s) 103
BsaJI CCNNGG 1 cut(s) 7
Bse1I ACTGG 1 cut(s) 22
BseDI CCNNGG 1 cut(s) 7
BseGI GGATG 1 cut(s) 17
BseNI ACTGG 1 cut(s) 22
BseYI CCCAGC 1 cut(s) 231
BshFI GGCC 1 cut(s) 5
BsmAI GTCTC 1 cut(s) 72
BsnI GGCC 1 cut(s) 5
BspANI GGCC 1 cut(s) 5
BspHI TCATGA 1 cut(s) 162
BsrI ACTGG 1 cut(s) 22
BssECI CCNNGG 1 cut(s) 7
BssT1I CCWWGG 1 cut(s) 7
BstC8I GCNNGC 1 cut(s) 238
BstEII GGTNACC 1 cut(s) 308
BstF5I GGATG 1 cut(s) 17
BstMAI GTCTC 1 cut(s) 72
BstMWI GCNNNNNNNGC 3 cut(s) 52, 107, 237
BstNSI RCATGY 1 cut(s) 55
BstPI GGTNACC 1 cut(s) 308
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 17
BtsIMutI CAGTG 1 cut(s) 15
Cac8I GCNNGC 1 cut(s) 238
CciI TCATGA 1 cut(s) 162
Cfr13I GGNCC 1 cut(s) 4
CviAII CATG 3 cut(s) 52, 163, 315
CviJI RGCY 9 cut(s) 5, 46, 110, 170, 203, 231, 240, 251, 273
CviKI_1 RGCY 9 cut(s) 5, 46, 110, 170, 203, 231, 240, 251, 273
Eco130I CCWWGG 1 cut(s) 7
Eco91I GGTNACC 1 cut(s) 308
EcoO65I GGTNACC 1 cut(s) 308
EcoT14I CCWWGG 1 cut(s) 7
ErhI CCWWGG 1 cut(s) 7
FaeI CATG 3 cut(s) 55, 166, 318
FaiI YATR 5 cut(s) 53, 68, 164, 175, 316
FatI CATG 3 cut(s) 51, 162, 314
FokI GGATG 1 cut(s) 24
FspBI CTAG 3 cut(s) 8, 107, 252
GsaI CCCAGC 1 cut(s) 235
GsuI CTGGAG 1 cut(s) 39
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 3 cut(s) 55, 166, 318
HindIII AAGCTT 1 cut(s) 238
HinfI GANTC 1 cut(s) 143
Hpy188I TCNGA 1 cut(s) 184
Hpy188III TCNNGA 3 cut(s) 77, 140, 163
HpyAV CCTTC 2 cut(s) 100, 160
HpyCH4V TGCA 2 cut(s) 15, 55
HpyF10VI GCNNNNNNNGC 3 cut(s) 52, 107, 237
Hsp92II CATG 3 cut(s) 55, 166, 318
LmnI GCTCC 1 cut(s) 228
LpnPI CCDG 3 cut(s) 3, 153, 217
LweI GCATC 1 cut(s) 2
MaeI CTAG 3 cut(s) 8, 107, 252
MaeIII GTNAC 2 cut(s) 212, 308
MboII GAAGA 2 cut(s) 213, 257
MluCI AATT 2 cut(s) 24, 190
MmeI TCCRAC 2 cut(s) 101, 278
MnlI CCTC 2 cut(s) 14, 241
MwoI GCNNNNNNNGC 3 cut(s) 52, 107, 237
NlaIII CATG 3 cut(s) 55, 166, 318
NspI RCATGY 1 cut(s) 55
PagI TCATGA 1 cut(s) 162
PcsI WCGNNNNNNNCGW 1 cut(s) 152
PfeI GAWTC 1 cut(s) 143
PspEI GGTNACC 1 cut(s) 308
PspFI CCCAGC 1 cut(s) 231
PspPI GGNCC 1 cut(s) 4
Sau96I GGNCC 1 cut(s) 4
SetI ASST 5 cut(s) 48, 205, 214, 233, 242
SfaNI GCATC 1 cut(s) 2
SmlI CTYRAG 1 cut(s) 82
SmoI CTYRAG 1 cut(s) 82
Sse9I AATT 2 cut(s) 24, 190
SspMI CTAG 3 cut(s) 8, 107, 252
StyI CCWWGG 1 cut(s) 7
TaqI TCGA 1 cut(s) 76
TasI AATT 2 cut(s) 24, 190
TfiI GAWTC 1 cut(s) 143
TscAI CASTG 1 cut(s) 22
TspDTI ATGAA 1 cut(s) 179
TspRI CASTG 1 cut(s) 22
XceI RCATGY 1 cut(s) 55
XmaJI CCTAGG 1 cut(s) 7
XspI CTAG 3 cut(s) 8, 107, 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.