RchiOBHm_Chr4g0393161

Belongs to the UDP-glycosyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
8712460 .. 8712723
264 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 264 bp
ATGATTGGGAGGCCTTACTTTGTTGACCTAAATTTAAATATGCGGAGTGTAGAAGTTGTATGGAAGATCGGTGTGAGGATTGAGGGAGGCGTTTTGACAAAAACTAGAGCAGTCAAGGCATTGGAACAAGTTTTATCGCTTGAACAAGGAAAAAAAATGAGACAGAGAAGTGGAATCCTTAAACAGCTTGCTCAAGAGGCTATTGGACTGAATGGGCGTTCAACTCAAGACTTGAAAGCTTCGGTAGAGATCATCAAGTCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.69

Weight (kDa)

10.27

Isoelectric Point (pI)

42.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000592)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04190 FvH4_2g02610 FvH4_3g13000 FvH4_4g03650 FvH4_4g03660 FvH4_4g09980
malus_domestica MD00G1134400.v1.1 MD16G1266400.v1.1 MD16G1266500.v1.1
prunus_persica Prupe.1G090400_v2.0.a1 Prupe.1G090500_v2.0.a1 Prupe.1G091000_v2.0.a1 Prupe.1G091100_v2.0.a1 Prupe.1G091100_v2.0.a1 Prupe.1G091200_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0393031 RchiOBHm_Chr4g0393051 RchiOBHm_Chr4g0393101 RchiOBHm_Chr4g0393121 RchiOBHm_Chr4g0393161 RchiOBHm_Chr4g0393201 RchiOBHm_Chr4g0393261 RchiOBHm_Chr4g0393271 RchiOBHm_Chr4g0403471
rosa_laevigata RLG00000002145 RLG00000008974 RLG00000009768 RLG00000009772
rosa_multiflora Rmu_co8079702.1_g000001 Rmu_co8169716.1_g000001 Rmu_co8283697.1_g000001 Rmu_co8424409.1_g000001 Rmu_co8489763.1_g000001 Rmu_co8489763.1_g000002 Rmu_sc0001590.1_g000014 Rmu_sc0004325.1_g000016 Rmu_sc0004828.1_g000004 Rmu_sc0004828.1_g000005 Rmu_sc0004828.1_g000007 Rmu_sc0007727.1_g000018 Rmu_sc0008186.1_g000005 Rmu_sc0008339.1_g000004 Rmu_sc0008339.1_g000008 Rmu_sc0009057.1_g000008 Rmu_sc0017178.1_g000006
rosa_roxburghii Rroxscaffold_5G00338130 Rroxscaffold_5G00338210 Rroxscaffold_5G00348140
rosa_rugosa Rorug04G0002000 Rorug04G0002100 Rorug04G0002100 Rorug04G0002200 Rorug04G0002300 Rorug04G0002400 Rorug04G0002500 Rorug04G0002600 Rorug04G0043500
rosa_samantha Rh4AG045600 Rh4AG045700 Rh4AG046000 Rh4AG046100 Rh4AG046200 Rh4AG046300 Rh4AG119100 Rh4BG041500 Rh4BG041700 Rh4BG041900 Rh4BG042000 Rh4BG112000 Rh4DG043000 Rh4DG043400 Rh4DG043500 Rh4DG043600 Rh4DG043700 Rh4DG111700 Rh7DG343500
rosa_wichuraiana Rw4G003590 Rw4G003620 Rw4G003660 Rw4G009660 Rw7G029290

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 43
AcsI RAATTY 1 cut(s) 31
AgsI TTSAA 3 cut(s) 143, 222, 235
AluBI AGCT 2 cut(s) 187, 239
AluI AGCT 2 cut(s) 187, 239
Alw26I GTCTC 1 cut(s) 154
AoxI GGCC 1 cut(s) 11
ApoI RAATTY 1 cut(s) 31
BcoDI GTCTC 1 cut(s) 154
BfaI CTAG 1 cut(s) 105
BpuEI CTTGAG 2 cut(s) 177, 210
BshFI GGCC 1 cut(s) 13
BsmAI GTCTC 1 cut(s) 154
BsnI GGCC 1 cut(s) 13
Bsp143I GATC 2 cut(s) 66, 249
BspACI CCGC 1 cut(s) 43
BspANI GGCC 1 cut(s) 13
BssMI GATC 2 cut(s) 66, 249
BstC8I GCNNGC 1 cut(s) 189
BstKTI GATC 2 cut(s) 69, 252
BstMAI GTCTC 1 cut(s) 154
BstMBI GATC 2 cut(s) 66, 249
BstMWI GCNNNNNNNGC 2 cut(s) 116, 197
BsuRI GGCC 1 cut(s) 13
Cac8I GCNNGC 1 cut(s) 189
CviJI RGCY 4 cut(s) 13, 187, 200, 239
CviKI_1 RGCY 4 cut(s) 13, 187, 200, 239
DpnI GATC 2 cut(s) 68, 251
DpnII GATC 2 cut(s) 66, 249
DraI TTTAAA 1 cut(s) 36
Eco147I AGGCCT 1 cut(s) 13
FaiI YATR 2 cut(s) 41, 61
FspBI CTAG 1 cut(s) 105
HaeIII GGCC 1 cut(s) 13
HincII GTYRAC 1 cut(s) 25
HindII GTYRAC 1 cut(s) 25
HindIII AAGCTT 1 cut(s) 237
HinfI GANTC 1 cut(s) 174
Hpy166II GTNNAC 1 cut(s) 25
Hpy188III TCNNGA 3 cut(s) 194, 227, 261
Hpy8I GTNNAC 1 cut(s) 25
HpyF10VI GCNNNNNNNGC 2 cut(s) 116, 197
Kzo9I GATC 2 cut(s) 66, 249
MaeI CTAG 1 cut(s) 105
MalI GATC 2 cut(s) 68, 251
MboI GATC 2 cut(s) 66, 249
MboII GAAGA 1 cut(s) 76
MluCI AATT 1 cut(s) 31
MnlI CCTC 5 cut(s) 3, 69, 76, 80, 190
MseI TTAA 2 cut(s) 35, 180
MwoI GCNNNNNNNGC 2 cut(s) 116, 197
NdeII GATC 2 cut(s) 66, 249
PceI AGGCCT 1 cut(s) 13
PfeI GAWTC 1 cut(s) 174
SaqAI TTAA 2 cut(s) 35, 180
Sau3AI GATC 2 cut(s) 66, 249
SetI ASST 3 cut(s) 30, 189, 241
SgeI CNNG 9 cut(s) 117, 127, 140, 152, 158, 200, 206, 239, 244
SmiI ATTTAAAT 1 cut(s) 36
SmlI CTYRAG 2 cut(s) 192, 225
SmoI CTYRAG 2 cut(s) 192, 225
Sse9I AATT 1 cut(s) 31
SseBI AGGCCT 1 cut(s) 13
SsiI CCGC 1 cut(s) 43
SspMI CTAG 1 cut(s) 105
StuI AGGCCT 1 cut(s) 13
SwaI ATTTAAAT 1 cut(s) 36
TasI AATT 1 cut(s) 31
TfiI GAWTC 1 cut(s) 174
Tru1I TTAA 2 cut(s) 35, 180
Tru9I TTAA 2 cut(s) 35, 180
XapI RAATTY 1 cut(s) 31
XspI CTAG 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.