Rh4AG046300

Belongs to the UDP-glycosyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
OG0000592
Physical Location & Seq
Forward (+)
9696393 .. 9696581
189 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG046300.1

Sequence Viewer

Length: 189 bp
ATGGGAGAGGGTGGTGTTTTTACTAAATCTGGAGCAATCAAGGTACTTGAACAAGCTCTATCGCTTGAGCAAGGAAAAGAAATGAGACACAGAGTTGGAATCCTTAAAAAACTTGCCCAAGAGGCTGTTGGATCCAATGGGAGTTCAGCTCAAGACTTGAAAGCTCTGGTAGAAATCATCAAATCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00942 ko01100 ko01110 map00942 map01100 map01110
Pfam Domains
Protein Families
UDPGT

Protein Analysis

62

Amino Acids

6.54

Weight (kDa)

9.22

Isoelectric Point (pI)

16.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000592)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04190 FvH4_2g02610 FvH4_3g13000 FvH4_4g03650 FvH4_4g03660 FvH4_4g09980
malus_domestica MD00G1134400.v1.1 MD16G1266400.v1.1 MD16G1266500.v1.1
prunus_persica Prupe.1G090400_v2.0.a1 Prupe.1G090500_v2.0.a1 Prupe.1G091000_v2.0.a1 Prupe.1G091100_v2.0.a1 Prupe.1G091100_v2.0.a1 Prupe.1G091200_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0393031 RchiOBHm_Chr4g0393051 RchiOBHm_Chr4g0393101 RchiOBHm_Chr4g0393121 RchiOBHm_Chr4g0393161 RchiOBHm_Chr4g0393201 RchiOBHm_Chr4g0393261 RchiOBHm_Chr4g0393271 RchiOBHm_Chr4g0403471
rosa_laevigata RLG00000002145 RLG00000008974 RLG00000009768 RLG00000009772
rosa_multiflora Rmu_co8079702.1_g000001 Rmu_co8169716.1_g000001 Rmu_co8283697.1_g000001 Rmu_co8424409.1_g000001 Rmu_co8489763.1_g000001 Rmu_co8489763.1_g000002 Rmu_sc0001590.1_g000014 Rmu_sc0004325.1_g000016 Rmu_sc0004828.1_g000004 Rmu_sc0004828.1_g000005 Rmu_sc0004828.1_g000007 Rmu_sc0007727.1_g000018 Rmu_sc0008186.1_g000005 Rmu_sc0008339.1_g000004 Rmu_sc0008339.1_g000008 Rmu_sc0009057.1_g000008 Rmu_sc0017178.1_g000006
rosa_roxburghii Rroxscaffold_5G00338130 Rroxscaffold_5G00338210 Rroxscaffold_5G00348140
rosa_rugosa Rorug04G0002000 Rorug04G0002100 Rorug04G0002100 Rorug04G0002200 Rorug04G0002300 Rorug04G0002400 Rorug04G0002500 Rorug04G0002600 Rorug04G0043500
rosa_samantha Rh4AG045600 Rh4AG045700 Rh4AG046000 Rh4AG046100 Rh4AG046200 Rh4AG046300 Rh4AG119100 Rh4BG041500 Rh4BG041700 Rh4BG041900 Rh4BG042000 Rh4BG112000 Rh4DG043000 Rh4DG043400 Rh4DG043500 Rh4DG043600 Rh4DG043700 Rh4DG111700 Rh7DG343500
rosa_wichuraiana Rw4G003590 Rw4G003620 Rw4G003660 Rw4G009660 Rw7G029290

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 126, 139
AfaI GTAC 1 cut(s) 45
AgsI TTSAA 2 cut(s) 50, 160
AluBI AGCT 3 cut(s) 56, 149, 164
AluI AGCT 3 cut(s) 56, 149, 164
Alw26I GTCTC 1 cut(s) 79
AlwI GGATC 2 cut(s) 126, 139
BamHI GGATCC 1 cut(s) 131
BcoDI GTCTC 1 cut(s) 79
BglI GCCNNNNNGGC 1 cut(s) 122
BmiI GGNNCC 1 cut(s) 133
BplI GAGNNNNNCTC 2 cut(s) 133, 165
BpmI CTGGAG 1 cut(s) 51
BpuEI CTTGAG 2 cut(s) 86, 135
BsmAI GTCTC 1 cut(s) 79
Bsp143I GATC 1 cut(s) 131
BspLI GGNNCC 1 cut(s) 133
BspPI GGATC 2 cut(s) 126, 139
BssMI GATC 1 cut(s) 131
BstKTI GATC 1 cut(s) 134
BstMAI GTCTC 1 cut(s) 79
BstMBI GATC 1 cut(s) 131
BstMWI GCNNNNNNNGC 1 cut(s) 122
BstX2I RGATCY 1 cut(s) 131
BstYI RGATCY 1 cut(s) 131
Csp6I GTAC 1 cut(s) 44
CviJI RGCY 4 cut(s) 56, 125, 149, 164
CviKI_1 RGCY 4 cut(s) 56, 125, 149, 164
CviQI GTAC 1 cut(s) 44
DpnI GATC 1 cut(s) 133
DpnII GATC 1 cut(s) 131
GsuI CTGGAG 1 cut(s) 51
HinfI GANTC 1 cut(s) 99
Hpy188III TCNNGA 3 cut(s) 30, 152, 186
HpyF10VI GCNNNNNNNGC 1 cut(s) 122
Kzo9I GATC 1 cut(s) 131
LmnI GCTCC 1 cut(s) 32
LpnPI CCDG 2 cut(s) 15, 152
MalI GATC 1 cut(s) 133
MboI GATC 1 cut(s) 131
MflI RGATCY 1 cut(s) 131
MmeI TCCRAC 2 cut(s) 76, 109
MnlI CCTC 1 cut(s) 115
MseI TTAA 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 122
NdeII GATC 1 cut(s) 131
NlaIV GGNNCC 1 cut(s) 133
PfeI GAWTC 1 cut(s) 99
PspN4I GGNNCC 1 cut(s) 133
PsuI RGATCY 1 cut(s) 131
RsaI GTAC 1 cut(s) 45
RsaNI GTAC 1 cut(s) 44
SaqAI TTAA 1 cut(s) 105
Sau3AI GATC 1 cut(s) 131
SetI ASST 4 cut(s) 45, 58, 151, 166
SmlI CTYRAG 2 cut(s) 65, 150
SmoI CTYRAG 2 cut(s) 65, 150
TfiI GAWTC 1 cut(s) 99
Tru1I TTAA 1 cut(s) 105
Tru9I TTAA 1 cut(s) 105
XcmI CCANNNNNNNNNTGG 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.