Rmu_co8489763.1_g000001

Belongs to the UDP-glycosyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8489763.1
OG0000592
Physical Location & Seq
Forward (+)
1 .. 541
541 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8489763.1_g000001.1.cds

Sequence Viewer

Length: 306 bp
ttcaccttcttcaacatttctagatcaaatagctccctcttctcaggttccggcaacaagggctgtgataatataaagccttacaacgtatgggatggcttaccagatggttacatacctctctccagaaatccacaacgggagcacgttgagttgtttattgacaatgcacctcggatcttcgagagggtaatcaaagaggtggaggctgaaacaggacacatgtttggctgcttgatttcggatgcattattctggtttgctgcagacatagctgagaaaatgcacatcccttgggtgacctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00942 ko01100 ko01110 map00942 map01100 map01110
Pfam Domains
Protein Families
UDPGT

Protein Analysis

101

Amino Acids

11.52

Weight (kDa)

5.21

Isoelectric Point (pI)

44.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000592)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04190 FvH4_2g02610 FvH4_3g13000 FvH4_4g03650 FvH4_4g03660 FvH4_4g09980
malus_domestica MD00G1134400.v1.1 MD16G1266400.v1.1 MD16G1266500.v1.1
prunus_persica Prupe.1G090400_v2.0.a1 Prupe.1G090500_v2.0.a1 Prupe.1G091000_v2.0.a1 Prupe.1G091100_v2.0.a1 Prupe.1G091100_v2.0.a1 Prupe.1G091200_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0393031 RchiOBHm_Chr4g0393051 RchiOBHm_Chr4g0393101 RchiOBHm_Chr4g0393121 RchiOBHm_Chr4g0393161 RchiOBHm_Chr4g0393201 RchiOBHm_Chr4g0393261 RchiOBHm_Chr4g0393271 RchiOBHm_Chr4g0403471
rosa_laevigata RLG00000002145 RLG00000008974 RLG00000009768 RLG00000009772
rosa_multiflora Rmu_co8079702.1_g000001 Rmu_co8169716.1_g000001 Rmu_co8283697.1_g000001 Rmu_co8424409.1_g000001 Rmu_co8489763.1_g000001 Rmu_co8489763.1_g000002 Rmu_sc0001590.1_g000014 Rmu_sc0004325.1_g000016 Rmu_sc0004828.1_g000004 Rmu_sc0004828.1_g000005 Rmu_sc0004828.1_g000007 Rmu_sc0007727.1_g000018 Rmu_sc0008186.1_g000005 Rmu_sc0008339.1_g000004 Rmu_sc0008339.1_g000008 Rmu_sc0009057.1_g000008 Rmu_sc0017178.1_g000006
rosa_roxburghii Rroxscaffold_5G00338130 Rroxscaffold_5G00338210 Rroxscaffold_5G00348140
rosa_rugosa Rorug04G0002000 Rorug04G0002100 Rorug04G0002100 Rorug04G0002200 Rorug04G0002300 Rorug04G0002400 Rorug04G0002500 Rorug04G0002600 Rorug04G0043500
rosa_samantha Rh4AG045600 Rh4AG045700 Rh4AG046000 Rh4AG046100 Rh4AG046200 Rh4AG046300 Rh4AG119100 Rh4BG041500 Rh4BG041700 Rh4BG041900 Rh4BG042000 Rh4BG112000 Rh4DG043000 Rh4DG043400 Rh4DG043500 Rh4DG043600 Rh4DG043700 Rh4DG111700 Rh7DG343500
rosa_wichuraiana Rw4G003590 Rw4G003620 Rw4G003660 Rw4G009660 Rw7G029290

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 185
AflIII ACRYGT 1 cut(s) 222
AgsI TTSAA 1 cut(s) 13
AluBI AGCT 2 cut(s) 33, 275
AluI AGCT 2 cut(s) 33, 275
Alw21I GWGCWC 1 cut(s) 147
AlwI GGATC 1 cut(s) 185
ApeKI GCWGC 2 cut(s) 231, 263
Bbv12I GWGCWC 1 cut(s) 147
BbvI GCAGC 2 cut(s) 218, 250
BccI CCATC 2 cut(s) 89, 101
BfaI CTAG 2 cut(s) 21, 304
BfmI CTRYAG 1 cut(s) 264
BisI GCNGC 2 cut(s) 232, 264
BlsI GCNGC 2 cut(s) 233, 265
BmiI GGNNCC 1 cut(s) 49
BmsI GCATC 1 cut(s) 235
BpmI CTGGAG 1 cut(s) 109
BsaJI CCNNGG 2 cut(s) 173, 293
BseDI CCNNGG 2 cut(s) 173, 293
BseGI GGATG 3 cut(s) 100, 250, 288
BseMII CTCAG 2 cut(s) 57, 267
BseXI GCAGC 2 cut(s) 218, 250
BsiHKAI GWGCWC 1 cut(s) 147
BsiSI CCGG 1 cut(s) 51
Bsp1286I GDGCHC 1 cut(s) 147
Bsp143I GATC 2 cut(s) 23, 177
BspCNI CTCAG 2 cut(s) 56, 268
BspLI GGNNCC 1 cut(s) 49
BspMAI CTGCAG 1 cut(s) 268
BspPI GGATC 1 cut(s) 185
BssECI CCNNGG 2 cut(s) 173, 293
BssMI GATC 2 cut(s) 23, 177
BssT1I CCWWGG 1 cut(s) 293
Bst6I CTCTTC 1 cut(s) 44
BstDEI CTNAG 2 cut(s) 43, 276
BstEII GGTNACC 1 cut(s) 298
BstF5I GGATG 3 cut(s) 100, 250, 288
BstKTI GATC 2 cut(s) 26, 180
BstMBI GATC 2 cut(s) 23, 177
BstMWI GCNNNNNNNGC 2 cut(s) 60, 272
BstNSI RCATGY 1 cut(s) 226
BstPI GGTNACC 1 cut(s) 298
BstSFI CTRYAG 1 cut(s) 264
BstV1I GCAGC 2 cut(s) 218, 250
BstX2I RGATCY 1 cut(s) 177
BstYI RGATCY 1 cut(s) 177
BtsCI GGATG 3 cut(s) 100, 250, 288
CviAII CATG 1 cut(s) 223
CviJI RGCY 7 cut(s) 33, 63, 79, 99, 209, 231, 275
CviKI_1 RGCY 7 cut(s) 33, 63, 79, 99, 209, 231, 275
DdeI CTNAG 2 cut(s) 43, 276
DpnI GATC 2 cut(s) 25, 179
DpnII GATC 2 cut(s) 23, 177
Eam1104I CTCTTC 1 cut(s) 44
EarI CTCTTC 1 cut(s) 44
Eco130I CCWWGG 1 cut(s) 293
Eco91I GGTNACC 1 cut(s) 298
EcoO65I GGTNACC 1 cut(s) 298
EcoT14I CCWWGG 1 cut(s) 293
EcoT22I ATGCAT 1 cut(s) 250
ErhI CCWWGG 1 cut(s) 293
FaeI CATG 1 cut(s) 226
FaiI YATR 5 cut(s) 74, 91, 116, 224, 272
FatI CATG 1 cut(s) 222
Fnu4HI GCNGC 2 cut(s) 232, 264
FokI GGATG 3 cut(s) 107, 257, 275
Fsp4HI GCNGC 2 cut(s) 232, 264
FspBI CTAG 2 cut(s) 21, 304
GluI GCNGC 2 cut(s) 232, 264
GsuI CTGGAG 1 cut(s) 109
HapII CCGG 1 cut(s) 51
Hin1II CATG 1 cut(s) 226
HpaII CCGG 1 cut(s) 51
Hpy188I TCNGA 2 cut(s) 177, 244
Hpy188III TCNNGA 3 cut(s) 21, 126, 184
HpyAV CCTTC 1 cut(s) 16
HpyCH4IV ACGT 2 cut(s) 87, 147
HpyCH4V TGCA 4 cut(s) 170, 248, 266, 286
HpyF10VI GCNNNNNNNGC 2 cut(s) 60, 272
HpyF3I CTNAG 2 cut(s) 43, 276
HpySE526I ACGT 2 cut(s) 87, 147
Hsp92II CATG 1 cut(s) 226
Kzo9I GATC 2 cut(s) 23, 177
LmnI GCTCC 2 cut(s) 38, 142
LpnPI CCDG 6 cut(s) 30, 64, 117, 139, 201, 241
Lsp1109I GCAGC 2 cut(s) 218, 250
LweI GCATC 1 cut(s) 235
MaeI CTAG 2 cut(s) 21, 304
MaeII ACGT 2 cut(s) 87, 147
MaeIII GTNAC 2 cut(s) 110, 298
MalI GATC 2 cut(s) 25, 179
MboI GATC 2 cut(s) 23, 177
MboII GAAGA 2 cut(s) 31, 172
MflI RGATCY 1 cut(s) 177
MhlI GDGCHC 1 cut(s) 147
MnlI CCTC 6 cut(s) 47, 129, 180, 183, 193, 199
Mph1103I ATGCAT 1 cut(s) 250
MspI CCGG 1 cut(s) 51
MwoI GCNNNNNNNGC 2 cut(s) 60, 272
NdeII GATC 2 cut(s) 23, 177
NlaIII CATG 1 cut(s) 226
NlaIV GGNNCC 1 cut(s) 49
NmuCI GTSAC 1 cut(s) 298
NsiI ATGCAT 1 cut(s) 250
NspI RCATGY 1 cut(s) 226
PciI ACATGT 1 cut(s) 222
PkrI GCNGC 2 cut(s) 233, 265
PscI ACATGT 1 cut(s) 222
PspEI GGTNACC 1 cut(s) 298
PspN4I GGNNCC 1 cut(s) 49
PstI CTGCAG 1 cut(s) 268
PsuI RGATCY 1 cut(s) 177
SatI GCNGC 2 cut(s) 232, 264
Sau3AI GATC 2 cut(s) 23, 177
SduI GDGCHC 1 cut(s) 147
SfaNI GCATC 1 cut(s) 235
SfcI CTRYAG 1 cut(s) 264
SspMI CTAG 2 cut(s) 21, 304
StyI CCWWGG 1 cut(s) 293
TaiI ACGT 2 cut(s) 90, 150
TaqI TCGA 1 cut(s) 183
TseFI GTSAC 1 cut(s) 298
TseI GCWGC 2 cut(s) 231, 263
Tsp45I GTSAC 1 cut(s) 298
XbaI TCTAGA 1 cut(s) 20
XceI RCATGY 1 cut(s) 226
XspI CTAG 2 cut(s) 21, 304
Zsp2I ATGCAT 1 cut(s) 250
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.