RchiOBHm_Chr1g0333841

Methyltransferase-like protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
25981479 .. 25983868
2390 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56262

Sequence Viewer

Length: 126 bp
ATGAAGGAGGTGCTAAGGGTTTGTAGGCAGTATTTTGGACCGGCAGATGGTGAGCACATCAATGTTTGTGTTAGAGATGCATTAAAAGTTATTGATAGGAAGCATTTTCTTTTGTCCATCAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

41

Amino Acids

4.83

Weight (kDa)

9.3

Isoelectric Point (pI)

16.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 47
Alw21I GWGCWC 1 cut(s) 57
AspS9I GGNCC 1 cut(s) 38
AsuHPI GGTGA 1 cut(s) 62
AvaII GGWCC 1 cut(s) 38
Bbv12I GWGCWC 1 cut(s) 57
BccI CCATC 2 cut(s) 41, 125
Bme18I GGWCC 1 cut(s) 38
BmgT120I GGNCC 1 cut(s) 38
BmsI GCATC 1 cut(s) 67
Bpu10I CCTNAGC 1 cut(s) 14
Bsc4I CCNNNNNNNGG 1 cut(s) 47
Bse118I RCCGGY 1 cut(s) 40
BseLI CCNNNNNNNGG 1 cut(s) 47
BsiHKAI GWGCWC 1 cut(s) 57
BsiSI CCGG 1 cut(s) 41
BslI CCNNNNNNNGG 1 cut(s) 47
Bsp1286I GDGCHC 1 cut(s) 57
BsrFI RCCGGY 1 cut(s) 40
BssAI RCCGGY 1 cut(s) 40
BstDEI CTNAG 1 cut(s) 14
Cfr10I RCCGGY 1 cut(s) 40
Cfr13I GGNCC 1 cut(s) 38
DdeI CTNAG 1 cut(s) 14
Eco47I GGWCC 1 cut(s) 38
EcoT22I ATGCAT 1 cut(s) 82
FspEI CC 7 cut(s) 2, 10, 21, 26, 33, 54, 82
HapII CCGG 1 cut(s) 41
HpaII CCGG 1 cut(s) 41
HphI GGTGA 1 cut(s) 62
Hpy188I TCNGA 1 cut(s) 122
HpyCH4V TGCA 1 cut(s) 80
HpyF3I CTNAG 1 cut(s) 14
LpnPI CCDG 1 cut(s) 54
LweI GCATC 1 cut(s) 67
MhlI GDGCHC 1 cut(s) 57
Mph1103I ATGCAT 1 cut(s) 82
MseI TTAA 1 cut(s) 83
MslI CAYNNNNRTG 1 cut(s) 60
MspI CCGG 1 cut(s) 41
NsiI ATGCAT 1 cut(s) 82
PspPI GGNCC 1 cut(s) 38
RseI CAYNNNNRTG 1 cut(s) 60
SaqAI TTAA 1 cut(s) 83
Sau96I GGNCC 1 cut(s) 38
SduI GDGCHC 1 cut(s) 57
SetI ASST 1 cut(s) 12
SfaNI GCATC 1 cut(s) 67
SgeI CNNG 1 cut(s) 53
SinI GGWCC 1 cut(s) 38
SmiMI CAYNNNNRTG 1 cut(s) 60
Tru1I TTAA 1 cut(s) 83
Tru9I TTAA 1 cut(s) 83
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 38
Zsp2I ATGCAT 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.