Rh1DG158000

Methyltransferase-like protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
32741819 .. 32742142
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG158000.1

Sequence Viewer

Length: 324 bp
ATGGTTGATTTGGATTCAAGTGATGCTAGGGATGGTCTAATTGCTCCGCCATTGGAGTTTGTTTGGAAGCAAGTCCTTTTGTCAGCCAGATCAATTCTCTCTGATAATGGAATCCTAGCTATAAATGTGATTCCTCCAAATACATCATTTTACAAGACATCGATCCATGAGTTTCGATATGTTTTTAAGGAGTTATACGAAATAGATGTGGGAAATGGGGAAAATTTTATTCTTGTTGTTGTGGCATCTCCTCTCATGCCTTCTAGTGATTGTGACAACTGTTTCCTCAACAAACTAGGAAAAGTTATATCAGGGCATACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

11.83

Weight (kDa)

4.74

Isoelectric Point (pI)

35.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 47
AclWI GGATC 1 cut(s) 157
AcsI RAATTY 1 cut(s) 223
AgsI TTSAA 1 cut(s) 18
AluBI AGCT 1 cut(s) 119
AluI AGCT 1 cut(s) 119
AlwI GGATC 1 cut(s) 157
ApoI RAATTY 1 cut(s) 223
BccI CCATC 1 cut(s) 26
BfaI CTAG 4 cut(s) 27, 116, 264, 296
BmsI GCATC 2 cut(s) 13, 254
Bsa29I ATCGAT 1 cut(s) 161
BseCI ATCGAT 1 cut(s) 161
BseGI GGATG 1 cut(s) 37
BseRI GAGGAG 1 cut(s) 240
BshVI ATCGAT 1 cut(s) 161
Bsp143I GATC 2 cut(s) 89, 162
BspACI CCGC 1 cut(s) 47
BspDI ATCGAT 1 cut(s) 161
BspPI GGATC 1 cut(s) 157
BssMI GATC 2 cut(s) 89, 162
Bst4CI ACNGT 1 cut(s) 281
BstF5I GGATG 1 cut(s) 37
BstKTI GATC 2 cut(s) 92, 165
BstMBI GATC 2 cut(s) 89, 162
Bsu15I ATCGAT 1 cut(s) 161
BsuTUI ATCGAT 1 cut(s) 161
BtsCI GGATG 1 cut(s) 37
ClaI ATCGAT 1 cut(s) 161
CviAII CATG 2 cut(s) 167, 256
CviJI RGCY 2 cut(s) 86, 119
CviKI_1 RGCY 2 cut(s) 86, 119
DpnI GATC 2 cut(s) 91, 164
DpnII GATC 2 cut(s) 89, 162
EciI GGCGGA 1 cut(s) 36
FaeI CATG 2 cut(s) 170, 259
FaiI YATR 7 cut(s) 122, 168, 180, 196, 257, 308, 318
FatI CATG 2 cut(s) 166, 255
FokI GGATG 1 cut(s) 44
FspBI CTAG 4 cut(s) 27, 116, 264, 296
Hin1II CATG 2 cut(s) 170, 259
HinfI GANTC 3 cut(s) 14, 111, 130
Hpy188I TCNGA 1 cut(s) 103
HpyAV CCTTC 1 cut(s) 270
HpyCH4III ACNGT 1 cut(s) 281
Hsp92II CATG 2 cut(s) 170, 259
Kzo9I GATC 2 cut(s) 89, 162
LmnI GCTCC 1 cut(s) 49
LpnPI CCDG 2 cut(s) 100, 297
LweI GCATC 2 cut(s) 13, 254
MaeI CTAG 4 cut(s) 27, 116, 264, 296
MaeIII GTNAC 1 cut(s) 272
MalI GATC 2 cut(s) 91, 164
MboI GATC 2 cut(s) 89, 162
MluCI AATT 3 cut(s) 39, 93, 223
MnlI CCTC 3 cut(s) 144, 261, 296
MseI TTAA 1 cut(s) 186
NdeII GATC 2 cut(s) 89, 162
NlaIII CATG 2 cut(s) 170, 259
NmuCI GTSAC 1 cut(s) 272
PfeI GAWTC 3 cut(s) 14, 111, 130
SaqAI TTAA 1 cut(s) 186
Sau3AI GATC 2 cut(s) 89, 162
SetI ASST 1 cut(s) 121
SfaNI GCATC 2 cut(s) 13, 254
Sse9I AATT 3 cut(s) 39, 93, 223
SsiI CCGC 1 cut(s) 47
SspMI CTAG 4 cut(s) 27, 116, 264, 296
TaaI ACNGT 1 cut(s) 281
TaqI TCGA 2 cut(s) 161, 175
TasI AATT 3 cut(s) 39, 93, 223
TfiI GAWTC 3 cut(s) 14, 111, 130
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TseFI GTSAC 1 cut(s) 272
Tsp45I GTSAC 1 cut(s) 272
XapI RAATTY 1 cut(s) 223
XspI CTAG 4 cut(s) 27, 116, 264, 296
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.