Rmu_co8244035.1_g000001

Methyltransferase-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8244035.1
OG0001235
Physical Location & Seq
Reverse (-)
2 .. 554
553 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8244035.1_g000001.1.cds

Sequence Viewer

Length: 226 bp
atgccagcaactcacactgttctgcacgtgcggtattttgggctagaagatggagagcatatcaaaatttgtgttggagatgttttaaaagtttttgatagacttgctggtgcctgcgaggtagaggctggttgtgacgtgggcagtgccaatgatgttgatactaaatttgatgtgattatggttgatttggattcaactgatgctagggatggtctaattgctc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Spermine_synth

Protein Analysis

75

Amino Acids

8.05

Weight (kDa)

4.35

Isoelectric Point (pI)

21.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 110
AciI CCGC 1 cut(s) 31
AcsI RAATTY 2 cut(s) 66, 167
AcvI CACGTG 1 cut(s) 28
AgsI TTSAA 1 cut(s) 198
AjiI CACGTC 1 cut(s) 139
ApoI RAATTY 2 cut(s) 66, 167
BanI GGYRCC 1 cut(s) 110
BbrPI CACGTG 1 cut(s) 28
BccI CCATC 2 cut(s) 44, 206
BfaI CTAG 2 cut(s) 44, 207
BmgBI CACGTC 1 cut(s) 139
BmiI GGNNCC 1 cut(s) 112
BmsI GCATC 1 cut(s) 193
BsaAI YACGTR 1 cut(s) 28
BseGI GGATG 1 cut(s) 217
BsgI GTGCAG 1 cut(s) 8
BshNI GGYRCC 1 cut(s) 110
BspACI CCGC 1 cut(s) 31
BspLI GGNNCC 1 cut(s) 112
BspT107I GGYRCC 1 cut(s) 110
Bst4CI ACNGT 1 cut(s) 19
BstBAI YACGTR 1 cut(s) 28
BstC8I GCNNGC 2 cut(s) 6, 115
BstF5I GGATG 1 cut(s) 217
BtrI CACGTC 1 cut(s) 139
BtsCI GGATG 1 cut(s) 217
BtsI GCAGTG 1 cut(s) 151
BtsIMutI CAGTG 2 cut(s) 15, 151
Cac8I GCNNGC 2 cut(s) 6, 115
CviJI RGCY 2 cut(s) 43, 128
CviKI_1 RGCY 2 cut(s) 43, 128
DraI TTTAAA 1 cut(s) 87
Eco72I CACGTG 1 cut(s) 28
FaiI YATR 2 cut(s) 60, 182
FspBI CTAG 2 cut(s) 44, 207
HinfI GANTC 1 cut(s) 194
HpyCH4III ACNGT 1 cut(s) 19
HpyCH4IV ACGT 2 cut(s) 27, 138
HpyCH4V TGCA 1 cut(s) 25
HpySE526I ACGT 2 cut(s) 27, 138
LpnPI CCDG 4 cut(s) 18, 93, 114, 127
LweI GCATC 1 cut(s) 193
MaeI CTAG 2 cut(s) 44, 207
MaeII ACGT 2 cut(s) 27, 138
MaeIII GTNAC 1 cut(s) 134
MboII GAAGA 1 cut(s) 59
MluCI AATT 3 cut(s) 66, 167, 219
MmeI TCCRAC 1 cut(s) 55
MnlI CCTC 2 cut(s) 112, 118
MseI TTAA 1 cut(s) 86
NlaIV GGNNCC 1 cut(s) 112
NmuCI GTSAC 1 cut(s) 134
PfeI GAWTC 1 cut(s) 194
PmaCI CACGTG 1 cut(s) 28
PmlI CACGTG 1 cut(s) 28
Ppu21I YACGTR 1 cut(s) 28
PspCI CACGTG 1 cut(s) 28
PspN4I GGNNCC 1 cut(s) 112
SaqAI TTAA 1 cut(s) 86
SetI ASST 3 cut(s) 30, 123, 141
SfaNI GCATC 1 cut(s) 193
Sse9I AATT 3 cut(s) 66, 167, 219
SsiI CCGC 1 cut(s) 31
SspMI CTAG 2 cut(s) 44, 207
TaaI ACNGT 1 cut(s) 19
TaiI ACGT 2 cut(s) 30, 141
TasI AATT 3 cut(s) 66, 167, 219
TfiI GAWTC 1 cut(s) 194
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
TscAI CASTG 2 cut(s) 22, 151
TseFI GTSAC 1 cut(s) 134
Tsp45I GTSAC 1 cut(s) 134
TspRI CASTG 2 cut(s) 22, 151
XapI RAATTY 2 cut(s) 66, 167
XspI CTAG 2 cut(s) 44, 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.