Rroxscaffold_4G00317130

Methyltransferase-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0001235
Physical Location & Seq
Forward (+)
42233388 .. 42236048
2661 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00317130.1

Sequence Viewer

Length: 261 bp
ATGGGCAGTGCCAATGATGTCGATACTAAATTTGATGTGATTATGGTTGATTTGGATTCAACTGATGCTAGGGATGGTCTAATTGCTCCGCCATTGGAGTTTGTTAGGAAGCATGTCCTTTTGTCAGCTAGATCAATTCTCTCTGATAATGGACTCCTAGCTATAAATGTGATTCCTCCAAATACATCAATTTACAAGACATTGATCCATGAGTTTCAAGATGTTTTTTATGAGTTATATGAAATAGACGTGGGAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Spermine_synth

Protein Analysis

86

Amino Acids

9.58

Weight (kDa)

4.31

Isoelectric Point (pI)

25.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 89
AclWI GGATC 1 cut(s) 199
AcsI RAATTY 1 cut(s) 29
AgsI TTSAA 2 cut(s) 60, 218
AjiI CACGTC 1 cut(s) 250
AluBI AGCT 2 cut(s) 128, 161
AluI AGCT 2 cut(s) 128, 161
AlwI GGATC 1 cut(s) 199
ApoI RAATTY 1 cut(s) 29
BccI CCATC 1 cut(s) 68
BfaI CTAG 3 cut(s) 69, 129, 158
BmgBI CACGTC 1 cut(s) 250
BmsI GCATC 1 cut(s) 55
BseGI GGATG 1 cut(s) 79
Bsp143I GATC 2 cut(s) 131, 204
BspACI CCGC 1 cut(s) 89
BspPI GGATC 1 cut(s) 199
BssMI GATC 2 cut(s) 131, 204
BstF5I GGATG 1 cut(s) 79
BstKTI GATC 2 cut(s) 134, 207
BstMBI GATC 2 cut(s) 131, 204
BstNSI RCATGY 1 cut(s) 116
BtrI CACGTC 1 cut(s) 250
BtsCI GGATG 1 cut(s) 79
BtsI GCAGTG 1 cut(s) 13
BtsIMutI CAGTG 1 cut(s) 13
CviAII CATG 2 cut(s) 113, 209
CviJI RGCY 2 cut(s) 128, 161
CviKI_1 RGCY 2 cut(s) 128, 161
DpnI GATC 2 cut(s) 133, 206
DpnII GATC 2 cut(s) 131, 204
EciI GGCGGA 1 cut(s) 78
FaeI CATG 2 cut(s) 116, 212
FaiI YATR 7 cut(s) 44, 114, 164, 210, 231, 238, 240
FatI CATG 2 cut(s) 112, 208
FokI GGATG 1 cut(s) 86
FspBI CTAG 3 cut(s) 69, 129, 158
Hin1II CATG 2 cut(s) 116, 212
HinfI GANTC 3 cut(s) 56, 153, 172
Hpy188I TCNGA 1 cut(s) 145
Hpy188III TCNNGA 1 cut(s) 218
HpyCH4IV ACGT 1 cut(s) 249
HpySE526I ACGT 1 cut(s) 249
Hsp92II CATG 2 cut(s) 116, 212
Kzo9I GATC 2 cut(s) 131, 204
LmnI GCTCC 1 cut(s) 91
LweI GCATC 1 cut(s) 55
MaeI CTAG 3 cut(s) 69, 129, 158
MaeII ACGT 1 cut(s) 249
MalI GATC 2 cut(s) 133, 206
MboI GATC 2 cut(s) 131, 204
MluCI AATT 5 cut(s) 29, 81, 135, 189, 256
MlyI GAGTC 1 cut(s) 147
MnlI CCTC 1 cut(s) 186
MseI TTAA 1 cut(s) 259
NdeII GATC 2 cut(s) 131, 204
NlaIII CATG 2 cut(s) 116, 212
NspI RCATGY 1 cut(s) 116
PfeI GAWTC 2 cut(s) 56, 172
PleI GAGTC 1 cut(s) 147
PpsI GAGTC 1 cut(s) 147
SaqAI TTAA 1 cut(s) 259
Sau3AI GATC 2 cut(s) 131, 204
SchI GAGTC 1 cut(s) 147
SetI ASST 3 cut(s) 130, 163, 252
SfaNI GCATC 1 cut(s) 55
SgeI CNNG 7 cut(s) 81, 125, 141, 170, 208, 221, 230
Sse9I AATT 5 cut(s) 29, 81, 135, 189, 256
SsiI CCGC 1 cut(s) 89
SspMI CTAG 3 cut(s) 69, 129, 158
TaiI ACGT 1 cut(s) 252
TaqI TCGA 1 cut(s) 21
TasI AATT 5 cut(s) 29, 81, 135, 189, 256
TfiI GAWTC 2 cut(s) 56, 172
Tru1I TTAA 1 cut(s) 259
Tru9I TTAA 1 cut(s) 259
TscAI CASTG 1 cut(s) 13
TspDTI ATGAA 1 cut(s) 255
TspRI CASTG 1 cut(s) 13
XapI RAATTY 1 cut(s) 29
XceI RCATGY 1 cut(s) 116
XspI CTAG 3 cut(s) 69, 129, 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.