Rh1CG128500

Methyltransferase-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0001235
Physical Location & Seq
Reverse (-)
28294366 .. 28295183
818 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG128500.1

Sequence Viewer

Length: 252 bp
ATGGTTGTCGGTGTGGAAGCTGATGAGGAGGTGCTAAGGGTTTCTAGGCGGTATTTTGGGCTAGAAGATGGAGAGCATATCAAAGTTTGTGTTGGAGATGTATTAAAAGTTTTTGATAGACTTGCTGGTGCCTGCGAGGTGGAGGTTGGGTGTGACGTGGGCAGTGCCAATGATGTCGATACTAAATTTGATGTGATTATGGTTGATTTGGATTCAACTGATGCTAGGGATGGTCTAATTGCTCCGCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Spermine_synth

Protein Analysis

83

Amino Acids

8.94

Weight (kDa)

4.16

Isoelectric Point (pI)

30.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 128
AciI CCGC 2 cut(s) 49, 245
AcsI RAATTY 1 cut(s) 185
AgsI TTSAA 1 cut(s) 216
AjiI CACGTC 1 cut(s) 157
AluBI AGCT 1 cut(s) 20
AluI AGCT 1 cut(s) 20
ApoI RAATTY 1 cut(s) 185
BanI GGYRCC 1 cut(s) 128
BccI CCATC 2 cut(s) 62, 224
BfaI CTAG 3 cut(s) 45, 62, 225
BmgBI CACGTC 1 cut(s) 157
BmiI GGNNCC 1 cut(s) 130
BmsI GCATC 1 cut(s) 211
Bpu10I CCTNAGC 1 cut(s) 35
BsaXI ACNNNNNCTCC 2 cut(s) 134, 164
BseGI GGATG 1 cut(s) 235
BseRI GAGGAG 1 cut(s) 41
BshNI GGYRCC 1 cut(s) 128
BspACI CCGC 2 cut(s) 49, 245
BspLI GGNNCC 1 cut(s) 130
BspT107I GGYRCC 1 cut(s) 128
BstC8I GCNNGC 1 cut(s) 133
BstDEI CTNAG 1 cut(s) 35
BstF5I GGATG 1 cut(s) 235
BtrI CACGTC 1 cut(s) 157
BtsCI GGATG 1 cut(s) 235
BtsI GCAGTG 1 cut(s) 169
BtsIMutI CAGTG 1 cut(s) 169
Cac8I GCNNGC 1 cut(s) 133
CviAII CATG 1 cut(s) 249
CviJI RGCY 2 cut(s) 20, 61
CviKI_1 RGCY 2 cut(s) 20, 61
DdeI CTNAG 1 cut(s) 35
EciI GGCGGA 1 cut(s) 234
FaeI CATG 1 cut(s) 252
FaiI YATR 3 cut(s) 78, 200, 250
FatI CATG 1 cut(s) 248
FokI GGATG 1 cut(s) 242
FspBI CTAG 3 cut(s) 45, 62, 225
Hin1II CATG 1 cut(s) 252
HinfI GANTC 1 cut(s) 212
HpyCH4IV ACGT 1 cut(s) 156
HpyF3I CTNAG 1 cut(s) 35
HpySE526I ACGT 1 cut(s) 156
Hsp92II CATG 1 cut(s) 252
LmnI GCTCC 1 cut(s) 247
LpnPI CCDG 2 cut(s) 111, 145
LweI GCATC 1 cut(s) 211
MaeI CTAG 3 cut(s) 45, 62, 225
MaeII ACGT 1 cut(s) 156
MaeIII GTNAC 1 cut(s) 152
MboII GAAGA 1 cut(s) 77
MluCI AATT 2 cut(s) 185, 237
MmeI TCCRAC 1 cut(s) 73
MnlI CCTC 4 cut(s) 19, 22, 130, 136
MseI TTAA 1 cut(s) 104
NlaIII CATG 1 cut(s) 252
NlaIV GGNNCC 1 cut(s) 130
NmuCI GTSAC 1 cut(s) 152
PfeI GAWTC 1 cut(s) 212
PspN4I GGNNCC 1 cut(s) 130
SaqAI TTAA 1 cut(s) 104
SetI ASST 5 cut(s) 22, 33, 141, 147, 159
SfaNI GCATC 1 cut(s) 211
SgeI CNNG 8 cut(s) 57, 74, 134, 138, 144, 148, 169, 237
Sse9I AATT 2 cut(s) 185, 237
SsiI CCGC 2 cut(s) 49, 245
SspMI CTAG 3 cut(s) 45, 62, 225
TaiI ACGT 1 cut(s) 159
TaqI TCGA 1 cut(s) 177
TasI AATT 2 cut(s) 185, 237
TfiI GAWTC 1 cut(s) 212
Tru1I TTAA 1 cut(s) 104
Tru9I TTAA 1 cut(s) 104
TscAI CASTG 1 cut(s) 169
TseFI GTSAC 1 cut(s) 152
Tsp45I GTSAC 1 cut(s) 152
TspRI CASTG 1 cut(s) 169
XapI RAATTY 1 cut(s) 185
XspI CTAG 3 cut(s) 45, 62, 225
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.