Rmu_sc0000115.1_g000006

Methyltransferase-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000115.1
Physical Location & Seq
Reverse (-)
50220 .. 51141
922 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000115.1_g000006.1.cds

Sequence Viewer

Length: 729 bp
atgttcacctgtgtattattacttttctcaatctattatcatctatcttgctttaaacatggcatttctgagatacccattttgagttacaaagataatgtgatttctactgtcgttttggagaaaagtgttgggcaattggttggtgcaatggtggtggaggatgtggagattgactgtggtggtcaggtctccaagagggagttaaggaggcgtttgacatgtaaaagaatgccaatttggttcagacggaggaggtattttgggctagaagatggagggcatatcaaagtttgtgttggagatgtattaaaagtttttgatagacttgctggtgcctgtgaggtagaggttggttgtgacgtaggcagtgccgatgatgttgatactaaatttgatgtgattatggttgatttggattcaagtgatgctagggatggtctaattgctccgccattggagtttgtttggaagcaagtccttttgtcagccagatcaattctctctgataatggaatcctagctataaatgtgattcctccaaatacatcattttacaagacattgatccatgagtttcgagatgtttttaaggagttatacgagatagatgtgggaaatggggaaaattttattcttgttgttgtggcatctcctctcatgccttctagtgattgtgacaactgtttcctcaacaaactaggaaaagttatatcagggcatacttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

242

Amino Acids

26.99

Weight (kDa)

5.27

Isoelectric Point (pI)

43.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 335
AciI CCGC 1 cut(s) 452
AclWI GGATC 1 cut(s) 562
AcsI RAATTY 2 cut(s) 392, 628
AflIII ACRYGT 1 cut(s) 221
AgsI TTSAA 1 cut(s) 423
AjuI GAANNNNNNNTTGG 2 cut(s) 223, 255
AluBI AGCT 1 cut(s) 524
AluI AGCT 1 cut(s) 524
Alw26I GTCTC 1 cut(s) 196
AlwI GGATC 1 cut(s) 562
ApoI RAATTY 2 cut(s) 392, 628
BanI GGYRCC 1 cut(s) 335
BccI CCATC 2 cut(s) 269, 431
BcoDI GTCTC 1 cut(s) 196
BfaI CTAG 5 cut(s) 269, 432, 521, 669, 701
BmiI GGNNCC 1 cut(s) 337
BmsI GCATC 2 cut(s) 418, 659
BsaI GGTCTC 1 cut(s) 196
Bse3DI GCAATG 1 cut(s) 156
BseGI GGATG 2 cut(s) 169, 442
BseMI GCAATG 1 cut(s) 156
BseMII CTCAG 1 cut(s) 60
BseRI GAGGAG 2 cut(s) 268, 645
BshNI GGYRCC 1 cut(s) 335
BsmAI GTCTC 1 cut(s) 196
BsmI GAATGC 1 cut(s) 237
Bso31I GGTCTC 1 cut(s) 196
Bsp143I GATC 2 cut(s) 494, 567
BspACI CCGC 1 cut(s) 452
BspCNI CTCAG 1 cut(s) 61
BspLI GGNNCC 1 cut(s) 337
BspPI GGATC 1 cut(s) 562
BspT107I GGYRCC 1 cut(s) 335
BspTNI GGTCTC 1 cut(s) 196
BsrDI GCAATG 1 cut(s) 156
BssMI GATC 2 cut(s) 494, 567
Bst4CI ACNGT 3 cut(s) 112, 179, 686
BstDEI CTNAG 1 cut(s) 69
BstF5I GGATG 2 cut(s) 169, 442
BstKTI GATC 2 cut(s) 497, 570
BstMAI GTCTC 1 cut(s) 196
BstMBI GATC 2 cut(s) 494, 567
BstNSI RCATGY 1 cut(s) 225
BtsCI GGATG 2 cut(s) 169, 442
BtsI GCAGTG 1 cut(s) 376
BtsIMutI CAGTG 1 cut(s) 376
CspCI CAANNNNNGTGG 2 cut(s) 138, 173
CviAII CATG 4 cut(s) 59, 222, 572, 661
CviJI RGCY 3 cut(s) 268, 491, 524
CviKI_1 RGCY 3 cut(s) 268, 491, 524
DdeI CTNAG 1 cut(s) 69
DpnI GATC 2 cut(s) 496, 569
DpnII GATC 2 cut(s) 494, 567
DraI TTTAAA 1 cut(s) 55
EciI GGCGGA 1 cut(s) 441
Eco31I GGTCTC 1 cut(s) 196
FaeI CATG 4 cut(s) 62, 225, 575, 664
FatI CATG 4 cut(s) 58, 221, 571, 660
FokI GGATG 2 cut(s) 176, 449
FspBI CTAG 5 cut(s) 269, 432, 521, 669, 701
Hin1II CATG 4 cut(s) 62, 225, 575, 664
HinfI GANTC 3 cut(s) 419, 516, 535
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 3 cut(s) 70, 248, 508
Hpy188III TCNNGA 1 cut(s) 581
Hpy8I GTNNAC 1 cut(s) 6
HpyAV CCTTC 1 cut(s) 675
HpyCH4III ACNGT 3 cut(s) 112, 179, 686
HpyCH4IV ACGT 1 cut(s) 363
HpyCH4V TGCA 1 cut(s) 149
HpyF3I CTNAG 1 cut(s) 69
HpySE526I ACGT 1 cut(s) 363
Hsp92II CATG 4 cut(s) 62, 225, 575, 664
Kzo9I GATC 2 cut(s) 494, 567
LmnI GCTCC 1 cut(s) 454
LpnPI CCDG 6 cut(s) 22, 173, 318, 352, 505, 702
LweI GCATC 2 cut(s) 418, 659
MaeI CTAG 5 cut(s) 269, 432, 521, 669, 701
MaeII ACGT 1 cut(s) 363
MaeIII GTNAC 3 cut(s) 86, 359, 677
MalI GATC 2 cut(s) 496, 569
MboI GATC 2 cut(s) 494, 567
MboII GAAGA 1 cut(s) 284
MfeI CAATTG 1 cut(s) 137
MluCI AATT 6 cut(s) 137, 237, 392, 444, 498, 628
MmeI TCCRAC 1 cut(s) 280
MseI TTAA 4 cut(s) 54, 206, 311, 591
MunI CAATTG 1 cut(s) 137
Mva1269I GAATGC 1 cut(s) 237
NdeII GATC 2 cut(s) 494, 567
NlaIII CATG 4 cut(s) 62, 225, 575, 664
NlaIV GGNNCC 1 cut(s) 337
NmuCI GTSAC 2 cut(s) 359, 677
NspI RCATGY 1 cut(s) 225
PciI ACATGT 1 cut(s) 221
PctI GAATGC 1 cut(s) 237
PfeI GAWTC 3 cut(s) 419, 516, 535
PscI ACATGT 1 cut(s) 221
PspN4I GGNNCC 1 cut(s) 337
SaqAI TTAA 4 cut(s) 54, 206, 311, 591
Sau3AI GATC 2 cut(s) 494, 567
SetI ASST 7 cut(s) 11, 192, 260, 348, 354, 366, 526
SfaNI GCATC 2 cut(s) 418, 659
Sse9I AATT 6 cut(s) 137, 237, 392, 444, 498, 628
SsiI CCGC 1 cut(s) 452
SspMI CTAG 5 cut(s) 269, 432, 521, 669, 701
TaaI ACNGT 3 cut(s) 112, 179, 686
TaiI ACGT 1 cut(s) 366
TaqI TCGA 1 cut(s) 580
TasI AATT 6 cut(s) 137, 237, 392, 444, 498, 628
TfiI GAWTC 3 cut(s) 419, 516, 535
Tru1I TTAA 4 cut(s) 54, 206, 311, 591
Tru9I TTAA 4 cut(s) 54, 206, 311, 591
TscAI CASTG 1 cut(s) 376
TseFI GTSAC 2 cut(s) 359, 677
Tsp45I GTSAC 2 cut(s) 359, 677
TspGWI ACGGA 1 cut(s) 265
TspRI CASTG 1 cut(s) 376
XapI RAATTY 2 cut(s) 392, 628
XceI RCATGY 1 cut(s) 225
XspI CTAG 5 cut(s) 269, 432, 521, 669, 701
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.