Rh1BG110900

Methyltransferase-like protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
19025142 .. 19025486
345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG110900.1

Sequence Viewer

Length: 345 bp
ATGGTTGATTTGGATTCAAGTGATGCTAGGGATGGTTTAATTGCTCCCCCATTGGAGTTTGTTTGGAAGCATATCCTTTTGTCAGCCAGATCAGTTCTCTGTGATAATGGAATCCTAGCTATAAATGTGATTCCTCCAAGTACATCATTTTACAGGACATTGATCCATGAGTTTCGAGATATTTTCAATGAGTTATACGAAGTAGATGTGGGAAACGGAGAAAATTTTATTCTTATTGCTGTGACTTCGCCTCTTATGCCTTCTAGTGATTGTGAGAACTGTTTCCTCAGCAAACTAGGGAAAGCTATATCAGGGGCATACTTGAATTCCATAAAGAAGATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

12.59

Weight (kDa)

4.8

Isoelectric Point (pI)

32.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 157
AcsI RAATTY 2 cut(s) 223, 325
AfaI GTAC 1 cut(s) 142
AgsI TTSAA 3 cut(s) 18, 187, 325
AluBI AGCT 2 cut(s) 119, 305
AluI AGCT 2 cut(s) 119, 305
AlwI GGATC 1 cut(s) 157
ApoI RAATTY 2 cut(s) 223, 325
Asp700I GAANNNNTTC 1 cut(s) 281
BbvCI CCTCAGC 1 cut(s) 287
BccI CCATC 1 cut(s) 26
BfaI CTAG 4 cut(s) 27, 116, 264, 296
BglII AGATCT 1 cut(s) 339
BmsI GCATC 1 cut(s) 13
Bpu10I CCTNAGC 1 cut(s) 287
BseGI GGATG 1 cut(s) 37
BseMII CTCAG 1 cut(s) 301
Bsp143I GATC 3 cut(s) 89, 162, 339
BspCNI CTCAG 1 cut(s) 300
BspPI GGATC 1 cut(s) 157
BssMI GATC 3 cut(s) 89, 162, 339
Bst4CI ACNGT 1 cut(s) 281
BstDEI CTNAG 1 cut(s) 287
BstF5I GGATG 1 cut(s) 37
BstKTI GATC 3 cut(s) 92, 165, 342
BstMBI GATC 3 cut(s) 89, 162, 339
BstMWI GCNNNNNNNGC 1 cut(s) 256
BstX2I RGATCY 1 cut(s) 339
BstYI RGATCY 1 cut(s) 339
BtsCI GGATG 1 cut(s) 37
Csp6I GTAC 1 cut(s) 141
CviAII CATG 1 cut(s) 167
CviJI RGCY 3 cut(s) 86, 119, 305
CviKI_1 RGCY 3 cut(s) 86, 119, 305
CviQI GTAC 1 cut(s) 141
DdeI CTNAG 1 cut(s) 287
DpnI GATC 3 cut(s) 91, 164, 341
DpnII GATC 3 cut(s) 89, 162, 339
EcoRI GAATTC 1 cut(s) 325
FaeI CATG 1 cut(s) 170
FaiI YATR 8 cut(s) 72, 122, 168, 196, 257, 308, 319, 332
FatI CATG 1 cut(s) 166
FokI GGATG 1 cut(s) 44
FspBI CTAG 4 cut(s) 27, 116, 264, 296
Hin1II CATG 1 cut(s) 170
HinfI GANTC 3 cut(s) 14, 111, 130
Hpy188III TCNNGA 1 cut(s) 176
HpyAV CCTTC 1 cut(s) 270
HpyCH4III ACNGT 1 cut(s) 281
HpyF10VI GCNNNNNNNGC 1 cut(s) 256
HpyF3I CTNAG 1 cut(s) 287
Hsp92II CATG 1 cut(s) 170
Kzo9I GATC 3 cut(s) 89, 162, 339
LmnI GCTCC 1 cut(s) 49
LpnPI CCDG 3 cut(s) 100, 139, 297
LweI GCATC 1 cut(s) 13
MaeI CTAG 4 cut(s) 27, 116, 264, 296
MaeIII GTNAC 1 cut(s) 241
MalI GATC 3 cut(s) 91, 164, 341
MboI GATC 3 cut(s) 89, 162, 339
MflI RGATCY 1 cut(s) 339
MluCI AATT 3 cut(s) 39, 223, 325
MnlI CCTC 3 cut(s) 144, 261, 296
MroXI GAANNNNTTC 1 cut(s) 281
MseI TTAA 1 cut(s) 38
MwoI GCNNNNNNNGC 1 cut(s) 256
NdeII GATC 3 cut(s) 89, 162, 339
NlaIII CATG 1 cut(s) 170
NmuCI GTSAC 1 cut(s) 241
PdmI GAANNNNTTC 1 cut(s) 281
PfeI GAWTC 3 cut(s) 14, 111, 130
PsuI RGATCY 1 cut(s) 339
RsaI GTAC 1 cut(s) 142
RsaNI GTAC 1 cut(s) 141
SaqAI TTAA 1 cut(s) 38
Sau3AI GATC 3 cut(s) 89, 162, 339
SetI ASST 2 cut(s) 121, 307
SfaNI GCATC 1 cut(s) 13
Sse9I AATT 3 cut(s) 39, 223, 325
SspMI CTAG 4 cut(s) 27, 116, 264, 296
TaaI ACNGT 1 cut(s) 281
TaqI TCGA 1 cut(s) 175
TasI AATT 3 cut(s) 39, 223, 325
TatI WGTACW 1 cut(s) 140
TfiI GAWTC 3 cut(s) 14, 111, 130
Tru1I TTAA 1 cut(s) 38
Tru9I TTAA 1 cut(s) 38
TseFI GTSAC 1 cut(s) 241
Tsp45I GTSAC 1 cut(s) 241
TspGWI ACGGA 1 cut(s) 231
XapI RAATTY 2 cut(s) 223, 325
XmnI GAANNNNTTC 1 cut(s) 281
XspI CTAG 4 cut(s) 27, 116, 264, 296
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.