Rmu_sc0006326.1_g000025

Methyltransferase-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006326.1
Physical Location & Seq
Reverse (-)
57926 .. 58473
548 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006326.1_g000025.1.cds

Sequence Viewer

Length: 462 bp
atgtcgtcgtgtgactacgaactcggggtgagcttgaaacctctctttcttgctttatctcccaagtctttctttaaacacggcattcctgagatacccattttgagttacgaagataatttgatttctagagtagttttggagaagtgtgttagatctttggttggtgaaatggtggtggaggatgtggagattgactatggtgatgaggtttcaaagagggagttcaggaggcatttgagatttaaaagaatgcctaatttggttcaggcggaggtgcgtattgttcccaaaatggtggcaagtcttagcctggatgctccttatattgagggacggattcgaagtggggtaaggccaaaagctttgtgtttaggagttggggatggagctttgcttggtttcttgagaacccaattgggttttcaggctgtgggtgtggaagcgatgaggaggtgctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

153

Amino Acids

17.14

Weight (kDa)

8.73

Isoelectric Point (pI)

52.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 272
AgsI TTSAA 2 cut(s) 37, 216
AjnI CCWGG 1 cut(s) 312
AjuI GAANNNNNNNTTGG 2 cut(s) 408, 440
AluBI AGCT 3 cut(s) 33, 365, 392
AluI AGCT 3 cut(s) 33, 365, 392
Ama87I CYCGRG 1 cut(s) 23
AoxI GGCC 1 cut(s) 356
AsuHPI GGTGA 3 cut(s) 40, 179, 215
AsuII TTCGAA 1 cut(s) 343
AvaI CYCGRG 1 cut(s) 23
BccI CCATC 1 cut(s) 380
BceAI ACGGC 1 cut(s) 97
BciT130I CCWGG 1 cut(s) 314
BfaI CTAG 1 cut(s) 129
BglII AGATCT 1 cut(s) 155
Bme1390I CCNGG 1 cut(s) 314
BmeT110I CYCGRG 1 cut(s) 23
BmrFI CCNGG 1 cut(s) 314
BmsI GCATC 1 cut(s) 307
Bpu14I TTCGAA 1 cut(s) 343
BpuEI CTTGAG 1 cut(s) 427
BseBI CCWGG 1 cut(s) 314
BseGI GGATG 3 cut(s) 190, 322, 391
BseMII CTCAG 1 cut(s) 81
BshFI GGCC 1 cut(s) 358
BsiHKCI CYCGRG 1 cut(s) 23
BslFI GGGAC 1 cut(s) 348
BsmFI GGGAC 1 cut(s) 348
BsmI GAATGC 2 cut(s) 84, 258
BsnI GGCC 1 cut(s) 358
BsoBI CYCGRG 1 cut(s) 23
Bsp119I TTCGAA 1 cut(s) 343
Bsp143I GATC 1 cut(s) 155
BspACI CCGC 1 cut(s) 272
BspANI GGCC 1 cut(s) 358
BspCNI CTCAG 1 cut(s) 82
BspT104I TTCGAA 1 cut(s) 343
BssMI GATC 1 cut(s) 155
Bst2UI CCWGG 1 cut(s) 314
BstBI TTCGAA 1 cut(s) 343
BstDEI CTNAG 2 cut(s) 90, 308
BstF5I GGATG 3 cut(s) 190, 322, 391
BstKTI GATC 1 cut(s) 158
BstMBI GATC 1 cut(s) 155
BstNI CCWGG 1 cut(s) 314
BstSCI CCNGG 1 cut(s) 312
BstX2I RGATCY 1 cut(s) 155
BstXI CCANNNNNNTGG 1 cut(s) 298
BstYI RGATCY 1 cut(s) 155
BsuRI GGCC 1 cut(s) 358
BtsCI GGATG 3 cut(s) 190, 322, 391
CviJI RGCY 6 cut(s) 33, 312, 358, 365, 392, 431
CviKI_1 RGCY 6 cut(s) 33, 312, 358, 365, 392, 431
DdeI CTNAG 2 cut(s) 90, 308
DpnI GATC 1 cut(s) 157
DpnII GATC 1 cut(s) 155
DraI TTTAAA 2 cut(s) 76, 247
EciI GGCGGA 1 cut(s) 287
Eco88I CYCGRG 1 cut(s) 23
EcoRII CCWGG 1 cut(s) 312
FaiI YATR 2 cut(s) 201, 327
FalI AAGNNNNNCTT 2 cut(s) 56, 88
FaqI GGGAC 1 cut(s) 348
FokI GGATG 3 cut(s) 197, 329, 398
FspBI CTAG 1 cut(s) 129
HaeIII GGCC 1 cut(s) 358
HindIII AAGCTT 1 cut(s) 363
HinfI GANTC 1 cut(s) 340
HphI GGTGA 3 cut(s) 40, 179, 215
Hpy188III TCNNGA 4 cut(s) 89, 129, 229, 406
Hpy99I CGWCG 1 cut(s) 10
HpyF3I CTNAG 2 cut(s) 90, 308
Kzo9I GATC 1 cut(s) 155
LmnI GCTCC 2 cut(s) 325, 389
LpnPI CCDG 6 cut(s) 102, 214, 254, 299, 326, 413
LweI GCATC 1 cut(s) 307
MaeI CTAG 1 cut(s) 129
MaeIII GTNAC 2 cut(s) 11, 107
MalI GATC 1 cut(s) 157
MboI GATC 1 cut(s) 155
MboII GAAGA 1 cut(s) 125
MfeI CAATTG 1 cut(s) 416
MflI RGATCY 1 cut(s) 155
MluCI AATT 3 cut(s) 118, 259, 416
MnlI CCTC 9 cut(s) 51, 175, 202, 213, 225, 268, 325, 444, 447
MseI TTAA 2 cut(s) 75, 246
MspR9I CCNGG 1 cut(s) 314
MunI CAATTG 1 cut(s) 416
Mva1269I GAATGC 2 cut(s) 84, 258
MvaI CCWGG 1 cut(s) 314
NdeII GATC 1 cut(s) 155
NmuCI GTSAC 1 cut(s) 11
NspV TTCGAA 1 cut(s) 343
PctI GAATGC 2 cut(s) 84, 258
PfeI GAWTC 1 cut(s) 340
Psp6I CCWGG 1 cut(s) 312
PspGI CCWGG 1 cut(s) 312
PsuI RGATCY 1 cut(s) 155
SaqAI TTAA 2 cut(s) 75, 246
Sau3AI GATC 1 cut(s) 155
ScrFI CCNGG 1 cut(s) 314
SetI ASST 7 cut(s) 35, 43, 213, 279, 367, 394, 458
SfaNI GCATC 1 cut(s) 307
SfuI TTCGAA 1 cut(s) 343
SmlI CTYRAG 1 cut(s) 406
SmoI CTYRAG 1 cut(s) 406
Sse9I AATT 3 cut(s) 118, 259, 416
SsiI CCGC 1 cut(s) 272
SspMI CTAG 1 cut(s) 129
StyD4I CCNGG 1 cut(s) 312
TaqI TCGA 1 cut(s) 343
TasI AATT 3 cut(s) 118, 259, 416
TfiI GAWTC 1 cut(s) 340
Tru1I TTAA 2 cut(s) 75, 246
Tru9I TTAA 2 cut(s) 75, 246
TseFI GTSAC 1 cut(s) 11
Tsp45I GTSAC 1 cut(s) 11
TspGWI ACGGA 1 cut(s) 352
XbaI TCTAGA 1 cut(s) 128
XspI CTAG 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.