RchiOBHm_Chr5g0042701

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0001407
Physical Location & Seq
Forward (+)
37502336 .. 37502826
491 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32108

Sequence Viewer

Length: 234 bp
ATGATAGAAGGAGATTGGACAATGCATCGGGTGGAAATTTTCTTAAGAAAGGTCCTAATGCCGCTTGGGATATTTGTGAGGAAGTGGCTACACAATCCGGTCAATGGGATAATCATCAAAGGAGAAGAGGAGGTAGAGATGACCGCACCACATCTAGAGGCCGAGTTGATATGGAGCCTCGTGGTAGAGGTGTGTACGATGTTTCTCATGTTGATAAAGATGATGGAGTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

9.08

Weight (kDa)

5.24

Isoelectric Point (pI)

47.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 62, 144
AcsI RAATTY 1 cut(s) 36
AfaI GTAC 1 cut(s) 196
AfiI CCNNNNNNNGG 1 cut(s) 104
AflII CTTAAG 1 cut(s) 43
AoxI GGCC 1 cut(s) 159
ApoI RAATTY 1 cut(s) 36
AspS9I GGNCC 1 cut(s) 52
AvaII GGWCC 1 cut(s) 52
BauI CACGAG 1 cut(s) 179
BccI CCATC 1 cut(s) 217
BfaI CTAG 1 cut(s) 155
BfrI CTTAAG 1 cut(s) 43
BisI GCNGC 1 cut(s) 62
BlsI GCNGC 1 cut(s) 63
Bme18I GGWCC 1 cut(s) 52
BmgT120I GGNCC 1 cut(s) 52
BmiI GGNNCC 1 cut(s) 176
BmsI GCATC 1 cut(s) 34
BsaBI GATNNNNATC 1 cut(s) 113
BsaWI WCCGGW 1 cut(s) 97
Bsc4I CCNNNNNNNGG 1 cut(s) 104
Bse8I GATNNNNATC 1 cut(s) 113
BseJI GATNNNNATC 1 cut(s) 113
BseLI CCNNNNNNNGG 1 cut(s) 104
BseRI GAGGAG 1 cut(s) 143
BshFI GGCC 1 cut(s) 161
BsiSI CCGG 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 104
BsnI GGCC 1 cut(s) 161
BspACI CCGC 2 cut(s) 62, 144
BspANI GGCC 1 cut(s) 161
BspLI GGNNCC 1 cut(s) 176
BspTI CTTAAG 1 cut(s) 43
BssSI CACGAG 1 cut(s) 179
Bst2BI CACGAG 1 cut(s) 179
Bst6I CTCTTC 1 cut(s) 120
BstAFI CTTAAG 1 cut(s) 43
BsuRI GGCC 1 cut(s) 161
Cfr13I GGNCC 1 cut(s) 52
Csp6I GTAC 1 cut(s) 195
CviAII CATG 1 cut(s) 208
CviJI RGCY 3 cut(s) 88, 161, 177
CviKI_1 RGCY 3 cut(s) 88, 161, 177
CviQI GTAC 1 cut(s) 195
Eam1104I CTCTTC 1 cut(s) 120
EarI CTCTTC 1 cut(s) 120
Eco47I GGWCC 1 cut(s) 52
EcoO109I RGGNCCY 1 cut(s) 52
EcoT22I ATGCAT 1 cut(s) 27
FaeI CATG 1 cut(s) 211
FaiI YATR 3 cut(s) 172, 209, 232
FatI CATG 1 cut(s) 207
Fnu4HI GCNGC 1 cut(s) 62
Fsp4HI GCNGC 1 cut(s) 62
FspBI CTAG 1 cut(s) 155
GluI GCNGC 1 cut(s) 62
HaeIII GGCC 1 cut(s) 161
HapII CCGG 1 cut(s) 98
Hin1II CATG 1 cut(s) 211
HpaII CCGG 1 cut(s) 98
Hpy166II GTNNAC 1 cut(s) 195
Hpy188III TCNNGA 1 cut(s) 155
Hpy8I GTNNAC 1 cut(s) 195
HpyCH4V TGCA 1 cut(s) 25
Hsp92II CATG 1 cut(s) 211
LmnI GCTCC 1 cut(s) 174
LpnPI CCDG 1 cut(s) 111
LweI GCATC 1 cut(s) 34
MaeI CTAG 1 cut(s) 155
MboII GAAGA 1 cut(s) 137
MluCI AATT 1 cut(s) 36
MnlI CCTC 6 cut(s) 72, 121, 124, 151, 181, 188
Mph1103I ATGCAT 1 cut(s) 27
MseI TTAA 1 cut(s) 44
MspCI CTTAAG 1 cut(s) 43
MspI CCGG 1 cut(s) 98
NlaIII CATG 1 cut(s) 211
NlaIV GGNNCC 1 cut(s) 176
NmeAIII GCCGAG 1 cut(s) 187
NsiI ATGCAT 1 cut(s) 27
PkrI GCNGC 1 cut(s) 63
PpuMI RGGWCCY 1 cut(s) 52
Psp5II RGGWCCY 1 cut(s) 52
PspN4I GGNNCC 1 cut(s) 176
PspPI GGNCC 1 cut(s) 52
PspPPI RGGWCCY 1 cut(s) 52
RsaI GTAC 1 cut(s) 196
RsaNI GTAC 1 cut(s) 195
SaqAI TTAA 1 cut(s) 44
SatI GCNGC 1 cut(s) 62
Sau96I GGNCC 1 cut(s) 52
SetI ASST 3 cut(s) 54, 135, 192
SfaNI GCATC 1 cut(s) 34
SgeI CNNG 8 cut(s) 41, 77, 110, 167, 175, 191, 193, 220
SinI GGWCC 1 cut(s) 52
SmlI CTYRAG 1 cut(s) 43
SmoI CTYRAG 1 cut(s) 43
Sse9I AATT 1 cut(s) 36
SsiI CCGC 2 cut(s) 62, 144
SspMI CTAG 1 cut(s) 155
TasI AATT 1 cut(s) 36
TauI GCSGC 1 cut(s) 64
Tru1I TTAA 1 cut(s) 44
Tru9I TTAA 1 cut(s) 44
Vha464I CTTAAG 1 cut(s) 43
VpaK11BI GGWCC 1 cut(s) 52
XapI RAATTY 1 cut(s) 36
XbaI TCTAGA 1 cut(s) 154
XspI CTAG 1 cut(s) 155
Zsp2I ATGCAT 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.