Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001124.1

Orthogroup ID

OG0001407

Physical Location & Seq

Genomic Coordinates Forward (+)

1261 .. 2561

Gene Structure 1301 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001124.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1227 bp

atgatccatactcacccacatacaatcccggttgaagaaatcatccaattttttcttggagagaccaaggaggttcatctagtgggtttcaaggtggaaatcaaagctttagaggtggccaaggtcaagactcatcaaatttcgctcattatggcaatgcacactaaggaaacactcaattttcacaatatggtcaacatggacagcaagcatacgggtggtggctattgtcctaacaagtttcaaggtgttcccattgcatcacaaccggaggagaagaagagtgcaaatgaggatgctctttctttgtctcaatgcattattatattatctcaaggtcaagccactatacaaaaacaaatgggactattagaagtacaaataagtcaaatggcaaaggagcttagcacacgtcaacaaggagctttacccggaaaactccatgaatgcaatgtcgttaccaccttacgtttggggaaggtatatgatattcaagtttacatgacttcatcttctagtttccattcaaatcctttatttgatgatgatgttgatatgcattcatatggggccaagagggaagaaaatgtacctcttggccatgttgttggtgataaattgcatgcacatcatgattctttttattataagaatgatgggatcagaagggaagaaaatataccttccagtaaatatgcagtgggtaatgtgactttgaatgcaaaagaaagaaataagggggtggataaggtagccggagaagaagaaaatgtaccctccggagatgttattcttggtaaaatatatggtttcttgtcatttgagaatgatgcgatcaaatatggtttgattgatagtggtaaggaaagggctatgttgagaaagaatacttctaggaataaggatatctcggcctcaagattagatagtgattccatgaaggctagggacccatctaaggtcgatgacacctctaggaaggtccttgatgacattagacccactcatgattttgagtcatctacttctaccgaaaaagggaggatgaataaggaggaaaacctccatgttcatggtagctataaggatagaagtggtcccgtctattcatcactagacgaggtcttgaaggctaagaaccctagtgagactgtgactacccttaggggcaccaccgggagtctcacctttgatccacctcttgatttgcacaaactggaggcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

408

Amino Acids

45.43

Weight (kDa)

6.35

Isoelectric Point (pI)

41.83

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001407)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g10250 FvH4_4g10250 FvH4_6g21790
rosa_chinensis	RchiOBHm_Chr2g0133891 RchiOBHm_Chr3g0452821 RchiOBHm_Chr3g0452831 RchiOBHm_Chr5g0042701 RchiOBHm_Chr5g0080601 RchiOBHm_Chr6g0279391
rosa_multiflora	Rmu_co8061076.1_g000001 Rmu_co8477889.1_g000001 Rmu_co8492139.1_g000002 Rmu_sc0000083.1_g000025 Rmu_sc0000084.1_g000033 Rmu_sc0000239.1_g000083 Rmu_sc0000427.1_g000012 Rmu_sc0000677.1_g000017 Rmu_sc0000684.1_g000015 Rmu_sc0000893.1_g000006 Rmu_sc0001047.1_g000017 Rmu_sc0001124.1_g000001 Rmu_sc0001353.1_g000052 Rmu_sc0001575.1_g000031 Rmu_sc0001687.1_g000017 Rmu_sc0002083.1_g000017 Rmu_sc0002083.1_g000018 Rmu_sc0002319.1_g000002 Rmu_sc0002385.1_g000007 Rmu_sc0002472.1_g000033 Rmu_sc0002564.1_g000008 Rmu_sc0002564.1_g000009 Rmu_sc0002702.1_g000010 Rmu_sc0003499.1_g000003 Rmu_sc0003527.1_g000011 Rmu_sc0003882.1_g000025 Rmu_sc0003882.1_g000047 Rmu_sc0004191.1_g000027 Rmu_sc0004431.1_g000007 Rmu_sc0005670.1_g000007 Rmu_sc0006954.1_g000001 Rmu_sc0008128.1_g000002 Rmu_sc0012865.1_g000004 Rmu_sc0013815.1_g000001 Rmu_sc0017745.1_g000001 Rmu_ssc0000350.1_g000007
rosa_roxburghii	Rroxscaffold_1G00030490 Rroxscaffold_2G00129400 Rroxscaffold_3G00218530 Rroxscaffold_4G00320090 Rroxscaffold_4G00322270
rosa_samantha	Rh1CG054500 Rh5BG351400
rosa_wichuraiana	Rw5G029510

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	648
AccB1I	GGYRCC	1 cut(s)	1169
AccIII	TCCGGA	1 cut(s)	779
AclWI	GGATC	2 cut(s)	668, 1187
AcoI	YGGCCR	2 cut(s)	117, 598
AcsI	RAATTY	1 cut(s)	138
AfaI	GTAC	3 cut(s)	378, 591, 774
AfiI	CCNNNNNNNGG	2 cut(s)	958, 1038
AflIII	ACRYGT	1 cut(s)	410
AgsI	TTSAA	7 cut(s)	35, 91, 245, 494, 528, 718, 1129
AjiI	CACGTC	1 cut(s)	413
AluBI	AGCT	4 cut(s)	107, 403, 425, 1080
AluI	AGCT	4 cut(s)	107, 403, 425, 1080
Alw26I	GTCTC	4 cut(s)	56, 315, 1142, 1187
AlwI	GGATC	2 cut(s)	668, 1187
Aor13HI	TCCGGA	1 cut(s)	779
AoxI	GGCC	4 cut(s)	117, 570, 598, 912
ApoI	RAATTY	1 cut(s)	138
AspS9I	GGNCC	4 cut(s)	570, 949, 982, 1097
AsuC2I	CCSGG	3 cut(s)	29, 432, 1177
AsuHPI	GGTGA	3 cut(s)	5, 623, 1177
AvaII	GGWCC	3 cut(s)	949, 982, 1097
AxyI	CCTNAGG	1 cut(s)	1163
BaeGI	GKGCMC	1 cut(s)	1172
BalI	TGGCCA	2 cut(s)	119, 600
BanI	GGYRCC	1 cut(s)	1169
BarI	GAAGNNNNNNTAC	6 cut(s)	573, 605, 663, 695, 756, 788
BccI	CCATC	2 cut(s)	650, 961
BcnI	CCSGG	3 cut(s)	29, 432, 1177
BcoDI	GTCTC	4 cut(s)	56, 315, 1142, 1187
BfaI	CTAG	7 cut(s)	80, 516, 894, 945, 975, 1115, 1143
BlpI	GCTNAGC	1 cut(s)	404
Bme1390I	CCNGG	3 cut(s)	29, 432, 1177
Bme18I	GGWCC	3 cut(s)	949, 982, 1097
BmgBI	CACGTC	1 cut(s)	413
BmgT120I	GGNCC	4 cut(s)	570, 949, 982, 1097
BmiI	GGNNCC	5 cut(s)	571, 950, 951, 1099, 1171
BmrFI	CCNGG	3 cut(s)	29, 432, 1177
BmsI	GCATC	3 cut(s)	269, 286, 820
Bpu1102I	GCTNAGC	1 cut(s)	404
BpuEI	CTTGAG	2 cut(s)	318, 901
BpuMI	CCSGG	3 cut(s)	29, 432, 1177
BsaI	GGTCTC	1 cut(s)	56
BsaJI	CCNNGG	2 cut(s)	66, 120
BsaWI	WCCGGW	2 cut(s)	268, 779
Bsc4I	CCNNNNNNNGG	2 cut(s)	958, 1038
Bse1I	ACTGG	2 cut(s)	687, 1221
Bse21I	CCTNAGG	1 cut(s)	1163
Bse3DI	GCAATG	3 cut(s)	162, 255, 457
BseAI	TCCGGA	1 cut(s)	779
BseDI	CCNNGG	2 cut(s)	66, 120
BseGI	GGATG	3 cut(s)	42, 301, 1050
BseLI	CCNNNNNNNGG	2 cut(s)	958, 1038
BseMI	GCAATG	3 cut(s)	162, 255, 457
BseNI	ACTGG	2 cut(s)	687, 1221
BseRI	GAGGAG	1 cut(s)	287
BseSI	GKGCMC	1 cut(s)	1172
BshFI	GGCC	4 cut(s)	119, 572, 600, 914
BshNI	GGYRCC	1 cut(s)	1169
BsiSI	CCGG	6 cut(s)	29, 269, 432, 756, 780, 1176
BslFI	GGGAC	3 cut(s)	378, 962, 1083
BslI	CCNNNNNNNGG	2 cut(s)	958, 1038
BsmAI	GTCTC	4 cut(s)	56, 315, 1142, 1187
BsmFI	GGGAC	3 cut(s)	378, 962, 1083
BsmI	GAATGC	3 cut(s)	452, 559, 724
BsnI	GGCC	4 cut(s)	119, 572, 600, 914
Bso31I	GGTCTC	1 cut(s)	56
Bsp1286I	GDGCHC	1 cut(s)	1172
Bsp13I	TCCGGA	1 cut(s)	779
Bsp143I	GATC	4 cut(s)	3, 660, 834, 1192
Bsp1720I	GCTNAGC	1 cut(s)	404
BspANI	GGCC	4 cut(s)	119, 572, 600, 914
BspEI	TCCGGA	1 cut(s)	779
BspHI	TCATGA	2 cut(s)	631, 1006
BspLI	GGNNCC	5 cut(s)	571, 950, 951, 1099, 1171
BspPI	GGATC	2 cut(s)	668, 1187
BspT107I	GGYRCC	1 cut(s)	1169
BspTNI	GGTCTC	1 cut(s)	56
BsrDI	GCAATG	3 cut(s)	162, 255, 457
BsrI	ACTGG	2 cut(s)	687, 1221
BssECI	CCNNGG	2 cut(s)	66, 120
BssMI	GATC	4 cut(s)	3, 660, 834, 1192
BssT1I	CCWWGG	2 cut(s)	66, 120
Bst4CI	ACNGT	1 cut(s)	1153
Bst6I	CTCTTC	1 cut(s)	275
BstC8I	GCNNGC	2 cut(s)	209, 624
BstDEI	CTNAG	5 cut(s)	165, 404, 957, 1134, 1163
BstF5I	GGATG	3 cut(s)	42, 301, 1050
BstKTI	GATC	4 cut(s)	6, 663, 837, 1195
BstMAI	GTCTC	4 cut(s)	56, 315, 1142, 1187
BstMBI	GATC	4 cut(s)	3, 660, 834, 1192
BstNSI	RCATGY	1 cut(s)	626
BstSCI	CCNGG	3 cut(s)	27, 430, 1175
BstSLI	GKGCMC	1 cut(s)	1172
BstXI	CCANNNNNNTGG	2 cut(s)	608, 1073
Bsu36I	CCTNAGG	1 cut(s)	1163
BsuRI	GGCC	4 cut(s)	119, 572, 600, 914
BtrI	CACGTC	1 cut(s)	413
BtsCI	GGATG	3 cut(s)	42, 301, 1050
BtsI	GCAGTG	1 cut(s)	705
BtsIMutI	CAGTG	1 cut(s)	705
Cac8I	GCNNGC	2 cut(s)	209, 624
CciI	TCATGA	2 cut(s)	631, 1006
Cfr13I	GGNCC	4 cut(s)	570, 949, 982, 1097
Csp6I	GTAC	3 cut(s)	377, 590, 773
CviQI	GTAC	3 cut(s)	377, 590, 773
DdeI	CTNAG	5 cut(s)	165, 404, 957, 1134, 1163
DpnI	GATC	4 cut(s)	5, 662, 836, 1194
DpnII	GATC	4 cut(s)	3, 660, 834, 1192
EaeI	YGGCCR	2 cut(s)	117, 598
Eam1104I	CTCTTC	1 cut(s)	275
EarI	CTCTTC	1 cut(s)	275
Eco130I	CCWWGG	2 cut(s)	66, 120
Eco31I	GGTCTC	1 cut(s)	56
Eco32I	GATATC	1 cut(s)	907
Eco47I	GGWCC	3 cut(s)	949, 982, 1097
Eco81I	CCTNAGG	1 cut(s)	1163
EcoO109I	RGGNCCY	2 cut(s)	949, 982
EcoRV	GATATC	1 cut(s)	907
EcoT14I	CCWWGG	2 cut(s)	66, 120
EcoT22I	ATGCAT	2 cut(s)	320, 561
ErhI	CCWWGG	2 cut(s)	66, 120
FaqI	GGGAC	3 cut(s)	378, 962, 1083
FauNDI	CATATG	1 cut(s)	565
FokI	GGATG	3 cut(s)	29, 308, 1057
FspBI	CTAG	7 cut(s)	80, 516, 894, 945, 975, 1115, 1143
HaeIII	GGCC	4 cut(s)	119, 572, 600, 914
HapII	CCGG	6 cut(s)	29, 269, 432, 756, 780, 1176
HincII	GTYRAC	2 cut(s)	196, 416
HindII	GTYRAC	2 cut(s)	196, 416
HindIII	AAGCTT	1 cut(s)	105
HinfI	GANTC	5 cut(s)	130, 635, 932, 1016, 1180
HpaII	CCGG	6 cut(s)	29, 269, 432, 756, 780, 1176
HphI	GGTGA	3 cut(s)	5, 623, 1177
Hpy166II	GTNNAC	3 cut(s)	196, 416, 499
Hpy188I	TCNGA	1 cut(s)	665
Hpy188III	TCNNGA	7 cut(s)	127, 632, 780, 918, 1007, 1126, 1202
Hpy8I	GTNNAC	3 cut(s)	196, 416, 499
HpyAV	CCTTC	6 cut(s)	472, 660, 693, 934, 973, 1123
HpyCH4III	ACNGT	1 cut(s)	1153
HpyCH4IV	ACGT	2 cut(s)	412, 469
HpyF3I	CTNAG	5 cut(s)	165, 404, 957, 1134, 1163
HpySE526I	ACGT	2 cut(s)	412, 469
KflI	GGGWCCC	1 cut(s)	949
Kpn2I	TCCGGA	1 cut(s)	779
Kzo9I	GATC	4 cut(s)	3, 660, 834, 1192
LmnI	GCTCC	2 cut(s)	400, 422
LpnPI	CCDG	8 cut(s)	42, 282, 445, 700, 769, 793, 1189, 1202
LweI	GCATC	3 cut(s)	269, 286, 820
MaeI	CTAG	7 cut(s)	80, 516, 894, 945, 975, 1115, 1143
MaeII	ACGT	2 cut(s)	412, 469
MaeIII	GTNAC	3 cut(s)	457, 709, 1153
MalI	GATC	4 cut(s)	5, 662, 836, 1194
MboI	GATC	4 cut(s)	3, 660, 834, 1192
MboII	GAAGA	8 cut(s)	47, 289, 292, 504, 593, 683, 773, 776
MhlI	GDGCHC	1 cut(s)	1172
MlsI	TGGCCA	2 cut(s)	119, 600
MluCI	AATT	4 cut(s)	47, 138, 178, 617
MluNI	TGGCCA	2 cut(s)	119, 600
MlyI	GAGTC	3 cut(s)	124, 1025, 1189
Mox20I	TGGCCA	2 cut(s)	119, 600
Mph1103I	ATGCAT	2 cut(s)	320, 561
MroI	TCCGGA	1 cut(s)	779
MscI	TGGCCA	2 cut(s)	119, 600
MseI	TTAA	1 cut(s)	1225
MslI	CAYNNNNRTG	3 cut(s)	216, 564, 1071
Msp20I	TGGCCA	2 cut(s)	119, 600
MspI	CCGG	6 cut(s)	29, 269, 432, 756, 780, 1176
MspR9I	CCNGG	3 cut(s)	29, 432, 1177
Mva1269I	GAATGC	3 cut(s)	452, 559, 724
NciI	CCSGG	3 cut(s)	29, 432, 1177
NdeI	CATATG	1 cut(s)	565
NdeII	GATC	4 cut(s)	3, 660, 834, 1192
NlaIV	GGNNCC	5 cut(s)	571, 950, 951, 1099, 1171
NmeAIII	GCCGAG	1 cut(s)	890
NmuCI	GTSAC	2 cut(s)	709, 1153
NsiI	ATGCAT	2 cut(s)	320, 561
NspI	RCATGY	1 cut(s)	626
PaeI	GCATGC	1 cut(s)	626
PagI	TCATGA	2 cut(s)	631, 1006
PctI	GAATGC	3 cut(s)	452, 559, 724
PfeI	GAWTC	2 cut(s)	635, 932
PflFI	GACNNNGTC	1 cut(s)	1121
PleI	GAGTC	3 cut(s)	124, 1024, 1188
PpsI	GAGTC	3 cut(s)	124, 1024, 1188
PpuMI	RGGWCCY	2 cut(s)	949, 982
PsiI	TTATAA	1 cut(s)	648
Psp5II	RGGWCCY	2 cut(s)	949, 982
PspN4I	GGNNCC	5 cut(s)	571, 950, 951, 1099, 1171
PspPI	GGNCC	4 cut(s)	570, 949, 982, 1097
PspPPI	RGGWCCY	2 cut(s)	949, 982
PsyI	GACNNNGTC	1 cut(s)	1121
RsaI	GTAC	3 cut(s)	378, 591, 774
RsaNI	GTAC	3 cut(s)	377, 590, 773
RseI	CAYNNNNRTG	3 cut(s)	216, 564, 1071
SaqAI	TTAA	1 cut(s)	1225
Sau3AI	GATC	4 cut(s)	3, 660, 834, 1192
Sau96I	GGNCC	4 cut(s)	570, 949, 982, 1097
SchI	GAGTC	3 cut(s)	124, 1025, 1189
ScrFI	CCNGG	3 cut(s)	29, 432, 1177
SduI	GDGCHC	1 cut(s)	1172
SfaNI	GCATC	3 cut(s)	269, 286, 820
SinI	GGWCC	3 cut(s)	949, 982, 1097
SmiMI	CAYNNNNRTG	3 cut(s)	216, 564, 1071
SmlI	CTYRAG	2 cut(s)	333, 916
SmoI	CTYRAG	2 cut(s)	333, 916
SphI	GCATGC	1 cut(s)	626
Sse9I	AATT	4 cut(s)	47, 138, 178, 617
SspMI	CTAG	7 cut(s)	80, 516, 894, 945, 975, 1115, 1143
StyD4I	CCNGG	3 cut(s)	27, 430, 1175
StyI	CCWWGG	2 cut(s)	66, 120
TaaI	ACNGT	1 cut(s)	1153
TaiI	ACGT	2 cut(s)	415, 472
TaqI	TCGA	1 cut(s)	963
TasI	AATT	4 cut(s)	47, 138, 178, 617
TatI	WGTACW	1 cut(s)	376
TfiI	GAWTC	2 cut(s)	635, 932
Tru1I	TTAA	1 cut(s)	1225
Tru9I	TTAA	1 cut(s)	1225
TscAI	CASTG	1 cut(s)	705
TseFI	GTSAC	2 cut(s)	709, 1153
Tsp45I	GTSAC	2 cut(s)	709, 1153
TspDTI	ATGAA	8 cut(s)	65, 459, 498, 552, 953, 1061, 1061, 1098
TspRI	CASTG	1 cut(s)	705
Tth111I	GACNNNGTC	1 cut(s)	1121
VpaK11BI	GGWCC	3 cut(s)	949, 982, 1097
XapI	RAATTY	1 cut(s)	138
XceI	RCATGY	1 cut(s)	626
XcmI	CCANNNNNNNNNTGG	2 cut(s)	53, 469
XspI	CTAG	7 cut(s)	80, 516, 894, 945, 975, 1115, 1143
Zsp2I	ATGCAT	2 cut(s)	320, 561

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.