Rmu_sc0000684.1_g000015

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000684.1
OG0001407
Physical Location & Seq
Forward (+)
43317 .. 43859
543 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000684.1_g000015.1.cds

Sequence Viewer

Length: 543 bp
atgcctacatcttctagtttccatacaaatcctttatttgatgacgatgttgatttgcattcatatggggccaagagggaagaaaatgtacctcttggccatgttgttgatgatcaattgcatacacattatgattctttttatcataaggaggatgggaccggaaggaaagaaaatgtaccttccggtaaatatggagtgggtgatgtgactttgaatgccaaaggaagaaataagggggtggataaggtatctagaggggaagaaaatgtatcctccggagaagctattcttggtaaaggttatggtttcttatcctttgagaacaatacaagcaaatatgggttgattgatagtggcaaggaaagagctttgttgagaaagaagacttctagggatgaggatgtctcagaccctaaattagatggtgagaccatgaaggctagggacccatctaaggccgatgacacctctagaaaggttcttgatgacattagacccaccactcatgagtttgagccatctacttctagagaaaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

180

Amino Acids

19.99

Weight (kDa)

5.66

Isoelectric Point (pI)

32.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 278
AcoI YGGCCR 1 cut(s) 97
AfaI GTAC 2 cut(s) 90, 180
AfiI CCNNNNNNNGG 1 cut(s) 457
AgsI TTSAA 1 cut(s) 217
AjuI GAANNNNNNNTTGG 2 cut(s) 276, 308
AluBI AGCT 2 cut(s) 287, 371
AluI AGCT 2 cut(s) 287, 371
Alw26I GTCTC 2 cut(s) 412, 425
Aor13HI TCCGGA 1 cut(s) 278
AoxI GGCC 3 cut(s) 69, 97, 459
Asp700I GAANNNNTTC 1 cut(s) 288
AspS9I GGNCC 3 cut(s) 69, 159, 448
AsuHPI GGTGA 2 cut(s) 215, 440
AvaII GGWCC 2 cut(s) 159, 448
BalI TGGCCA 1 cut(s) 99
BarI GAAGNNNNNNTAC 2 cut(s) 72, 104
BbsI GAAGAC 1 cut(s) 392
BccI CCATC 4 cut(s) 149, 419, 460, 529
BciVI GTATCC 1 cut(s) 283
BclI TGATCA 1 cut(s) 112
BcoDI GTCTC 2 cut(s) 412, 425
BfaI CTAG 6 cut(s) 15, 255, 393, 444, 474, 531
BfuI GTATCC 1 cut(s) 283
Bme18I GGWCC 2 cut(s) 159, 448
BmgT120I GGNCC 3 cut(s) 69, 159, 448
BmiI GGNNCC 4 cut(s) 70, 160, 449, 450
BpiI GAAGAC 1 cut(s) 392
BplI GAGNNNNNCTC 2 cut(s) 392, 424
BsaI GGTCTC 1 cut(s) 425
BsaWI WCCGGW 3 cut(s) 161, 185, 278
Bsc4I CCNNNNNNNGG 1 cut(s) 457
BseAI TCCGGA 1 cut(s) 278
BseGI GGATG 3 cut(s) 160, 403, 409
BseLI CCNNNNNNNGG 1 cut(s) 457
BseMII CTCAG 1 cut(s) 423
BshFI GGCC 3 cut(s) 71, 99, 461
BsiSI CCGG 3 cut(s) 162, 186, 279
BslFI GGGAC 2 cut(s) 172, 461
BslI CCNNNNNNNGG 1 cut(s) 457
BsmAI GTCTC 2 cut(s) 412, 425
BsmFI GGGAC 2 cut(s) 172, 461
BsmI GAATGC 2 cut(s) 58, 223
BsnI GGCC 3 cut(s) 71, 99, 461
Bso31I GGTCTC 1 cut(s) 425
Bsp13I TCCGGA 1 cut(s) 278
Bsp143I GATC 1 cut(s) 112
BspANI GGCC 3 cut(s) 71, 99, 461
BspCNI CTCAG 1 cut(s) 422
BspEI TCCGGA 1 cut(s) 278
BspHI TCATGA 1 cut(s) 508
BspLI GGNNCC 4 cut(s) 70, 160, 449, 450
BspTNI GGTCTC 1 cut(s) 425
BssMI GATC 1 cut(s) 112
BstDEI CTNAG 2 cut(s) 409, 456
BstF5I GGATG 3 cut(s) 160, 403, 409
BstKTI GATC 1 cut(s) 115
BstMAI GTCTC 2 cut(s) 412, 425
BstMBI GATC 1 cut(s) 112
BstV2I GAAGAC 1 cut(s) 392
BsuI GTATCC 1 cut(s) 283
BsuRI GGCC 3 cut(s) 71, 99, 461
BtsCI GGATG 3 cut(s) 160, 403, 409
CciI TCATGA 1 cut(s) 508
Cfr13I GGNCC 3 cut(s) 69, 159, 448
Csp6I GTAC 2 cut(s) 89, 179
CviAII CATG 3 cut(s) 101, 436, 509
CviJI RGCY 7 cut(s) 71, 99, 287, 371, 443, 461, 520
CviKI_1 RGCY 7 cut(s) 71, 99, 287, 371, 443, 461, 520
CviQI GTAC 2 cut(s) 89, 179
DdeI CTNAG 2 cut(s) 409, 456
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
EaeI YGGCCR 1 cut(s) 97
Eco31I GGTCTC 1 cut(s) 425
Eco47I GGWCC 2 cut(s) 159, 448
EcoO109I RGGNCCY 1 cut(s) 448
FaeI CATG 3 cut(s) 104, 439, 512
FalI AAGNNNNNCTT 2 cut(s) 276, 308
FaqI GGGAC 2 cut(s) 172, 461
FatI CATG 3 cut(s) 100, 435, 508
FauNDI CATATG 1 cut(s) 64
FbaI TGATCA 1 cut(s) 112
FokI GGATG 3 cut(s) 167, 410, 416
FspBI CTAG 6 cut(s) 15, 255, 393, 444, 474, 531
HaeIII GGCC 3 cut(s) 71, 99, 461
HapII CCGG 3 cut(s) 162, 186, 279
Hin1II CATG 3 cut(s) 104, 439, 512
HinfI GANTC 1 cut(s) 134
HpaII CCGG 3 cut(s) 162, 186, 279
HphI GGTGA 2 cut(s) 215, 440
Hpy188I TCNGA 1 cut(s) 412
Hpy188III TCNNGA 6 cut(s) 255, 279, 474, 485, 509, 531
HpyAV CCTTC 3 cut(s) 159, 192, 433
HpyCH4V TGCA 2 cut(s) 58, 121
HpyF3I CTNAG 2 cut(s) 409, 456
Hsp92II CATG 3 cut(s) 104, 439, 512
KflI GGGWCCC 1 cut(s) 448
Kpn2I TCCGGA 1 cut(s) 278
Ksp22I TGATCA 1 cut(s) 112
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 3 cut(s) 175, 199, 292
MaeI CTAG 6 cut(s) 15, 255, 393, 444, 474, 531
MaeIII GTNAC 1 cut(s) 208
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MboII GAAGA 5 cut(s) 3, 92, 240, 275, 397
MfeI CAATTG 1 cut(s) 116
MlsI TGGCCA 1 cut(s) 99
MluCI AATT 2 cut(s) 116, 419
MluNI TGGCCA 1 cut(s) 99
MnlI CCTC 7 cut(s) 69, 102, 145, 251, 286, 394, 481
Mox20I TGGCCA 1 cut(s) 99
MroI TCCGGA 1 cut(s) 278
MroXI GAANNNNTTC 1 cut(s) 288
MscI TGGCCA 1 cut(s) 99
MslI CAYNNNNRTG 1 cut(s) 63
Msp20I TGGCCA 1 cut(s) 99
MspI CCGG 3 cut(s) 162, 186, 279
MunI CAATTG 1 cut(s) 116
Mva1269I GAATGC 2 cut(s) 58, 223
NdeI CATATG 1 cut(s) 64
NdeII GATC 1 cut(s) 112
NlaIII CATG 3 cut(s) 104, 439, 512
NlaIV GGNNCC 4 cut(s) 70, 160, 449, 450
NmuCI GTSAC 1 cut(s) 208
PagI TCATGA 1 cut(s) 508
PctI GAATGC 2 cut(s) 58, 223
PdmI GAANNNNTTC 1 cut(s) 288
PfeI GAWTC 1 cut(s) 134
PpuMI RGGWCCY 1 cut(s) 448
Psp5II RGGWCCY 1 cut(s) 448
PspN4I GGNNCC 4 cut(s) 70, 160, 449, 450
PspPI GGNCC 3 cut(s) 69, 159, 448
PspPPI RGGWCCY 1 cut(s) 448
RsaI GTAC 2 cut(s) 90, 180
RsaNI GTAC 2 cut(s) 89, 179
RseI CAYNNNNRTG 1 cut(s) 63
Sau3AI GATC 1 cut(s) 112
Sau96I GGNCC 3 cut(s) 69, 159, 448
SetI ASST 8 cut(s) 94, 184, 252, 289, 304, 373, 473, 483
SinI GGWCC 2 cut(s) 159, 448
SmiMI CAYNNNNRTG 1 cut(s) 63
Sse9I AATT 2 cut(s) 116, 419
SspMI CTAG 6 cut(s) 15, 255, 393, 444, 474, 531
TasI AATT 2 cut(s) 116, 419
TfiI GAWTC 1 cut(s) 134
TseFI GTSAC 1 cut(s) 208
Tsp45I GTSAC 1 cut(s) 208
TspDTI ATGAA 2 cut(s) 51, 452
VpaK11BI GGWCC 2 cut(s) 159, 448
XbaI TCTAGA 3 cut(s) 254, 473, 530
XmnI GAANNNNTTC 1 cut(s) 288
XspI CTAG 6 cut(s) 15, 255, 393, 444, 474, 531
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.