Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002083.1

Orthogroup ID

OG0001407

Physical Location & Seq

Genomic Coordinates Forward (+)

79200 .. 79901

Gene Structure 702 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002083.1_g000017.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 702 bp

atgggagagtttctcaaggttcaaacttctactaatgcggagaccaaacaaaacatctcttcactagttcaagggtatcaaactctacaacaaggcatggctagactagaggtacaagtgggtcaaatggccaccaatatgagtgagagaccaaaaggagccttaccttcacaaccggagccaaatccaagagaaaaactccatgaatgcaatgccatcaccactctacgttcgggaaaggtatatgataatcatgtttacatgcctacatcttctagtttccatacaaatcctttatttgatgatgatgttgatttgcattcatatggggccaagagggaagaaaatgtacctcttggccatgttgttgatgatcaattgcatacacattatgattttttttatcataaggaggatgggaccggaagggaagaaaatgtaccttccggtaaatatggagtgggtgatgtgactttgaatgccaaaggaagaaataagggggtggataaggtagccggaggggaagaaaatgtaccctccggagaatctattcttggtaaaggttatggtttcttgtcatttgagaacaatgcaagcaaatatggtttgattgatagtggcaaagaaagggccatgttgagaaagaagacttctagggatgaggatgtctcggaccctaaattagatggtgaggcctcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_1 Retrotrans_gag rve

Protein Analysis

233

Amino Acids

25.67

Weight (kDa)

5.51

Isoelectric Point (pI)

42.52

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001407)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g10250 FvH4_4g10250 FvH4_6g21790
rosa_chinensis	RchiOBHm_Chr2g0133891 RchiOBHm_Chr3g0452821 RchiOBHm_Chr3g0452831 RchiOBHm_Chr5g0042701 RchiOBHm_Chr5g0080601 RchiOBHm_Chr6g0279391
rosa_multiflora	Rmu_co8061076.1_g000001 Rmu_co8477889.1_g000001 Rmu_co8492139.1_g000002 Rmu_sc0000083.1_g000025 Rmu_sc0000084.1_g000033 Rmu_sc0000239.1_g000083 Rmu_sc0000427.1_g000012 Rmu_sc0000677.1_g000017 Rmu_sc0000684.1_g000015 Rmu_sc0000893.1_g000006 Rmu_sc0001047.1_g000017 Rmu_sc0001124.1_g000001 Rmu_sc0001353.1_g000052 Rmu_sc0001575.1_g000031 Rmu_sc0001687.1_g000017 Rmu_sc0002083.1_g000017 Rmu_sc0002083.1_g000018 Rmu_sc0002319.1_g000002 Rmu_sc0002385.1_g000007 Rmu_sc0002472.1_g000033 Rmu_sc0002564.1_g000008 Rmu_sc0002564.1_g000009 Rmu_sc0002702.1_g000010 Rmu_sc0003499.1_g000003 Rmu_sc0003527.1_g000011 Rmu_sc0003882.1_g000025 Rmu_sc0003882.1_g000047 Rmu_sc0004191.1_g000027 Rmu_sc0004431.1_g000007 Rmu_sc0005670.1_g000007 Rmu_sc0006954.1_g000001 Rmu_sc0008128.1_g000002 Rmu_sc0012865.1_g000004 Rmu_sc0013815.1_g000001 Rmu_sc0017745.1_g000001 Rmu_ssc0000350.1_g000007
rosa_roxburghii	Rroxscaffold_1G00030490 Rroxscaffold_2G00129400 Rroxscaffold_3G00218530 Rroxscaffold_4G00320090 Rroxscaffold_4G00322270
rosa_samantha	Rh1CG054500 Rh5BG351400
rosa_wichuraiana	Rw5G029510

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccIII	TCCGGA	1 cut(s)	539
AciI	CCGC	1 cut(s)	38
AcoI	YGGCCR	2 cut(s)	129, 358
AfaI	GTAC	4 cut(s)	114, 351, 441, 534
AgsI	TTSAA	3 cut(s)	23, 71, 478
AhlI	ACTAGT	1 cut(s)	64
AjuI	GAANNNNNNNTTGG	2 cut(s)	537, 569
Alw26I	GTCTC	3 cut(s)	35, 142, 673
Aor13HI	TCCGGA	1 cut(s)	539
AoxI	GGCC	5 cut(s)	129, 330, 358, 630, 693
Asp700I	GAANNNNTTC	1 cut(s)	549
AspS9I	GGNCC	4 cut(s)	330, 420, 630, 673
AsuHPI	GGTGA	3 cut(s)	211, 476, 701
AvaII	GGWCC	2 cut(s)	420, 673
BalI	TGGCCA	2 cut(s)	131, 360
BarI	GAAGNNNNNNTAC	6 cut(s)	333, 365, 423, 455, 516, 548
BbsI	GAAGAC	1 cut(s)	653
BccI	CCATC	3 cut(s)	224, 410, 680
BclI	TGATCA	1 cut(s)	373
BcoDI	GTCTC	3 cut(s)	35, 142, 673
BcuI	ACTAGT	1 cut(s)	64
BfaI	CTAG	5 cut(s)	65, 102, 107, 276, 654
Bme18I	GGWCC	2 cut(s)	420, 673
BmgT120I	GGNCC	4 cut(s)	330, 420, 630, 673
BmiI	GGNNCC	5 cut(s)	160, 180, 331, 421, 675
BpiI	GAAGAC	1 cut(s)	653
BplI	GAGNNNNNCTC	5 cut(s)	29, 183, 215, 653, 685
BsaI	GGTCTC	2 cut(s)	35, 142
BsaWI	WCCGGW	4 cut(s)	175, 422, 446, 539
Bse3DI	GCAATG	1 cut(s)	217
BseAI	TCCGGA	1 cut(s)	539
BseGI	GGATG	3 cut(s)	421, 664, 670
BseMI	GCAATG	1 cut(s)	217
BshFI	GGCC	5 cut(s)	131, 332, 360, 632, 695
BsiSI	CCGG	5 cut(s)	176, 423, 447, 516, 540
BslFI	GGGAC	1 cut(s)	433
BsmAI	GTCTC	3 cut(s)	35, 142, 673
BsmFI	GGGAC	1 cut(s)	433
BsmI	GAATGC	3 cut(s)	212, 319, 484
BsnI	GGCC	5 cut(s)	131, 332, 360, 632, 695
Bso31I	GGTCTC	2 cut(s)	35, 142
Bsp13I	TCCGGA	1 cut(s)	539
Bsp143I	GATC	1 cut(s)	373
BspACI	CCGC	1 cut(s)	38
BspANI	GGCC	5 cut(s)	131, 332, 360, 632, 695
BspEI	TCCGGA	1 cut(s)	539
BspLI	GGNNCC	5 cut(s)	160, 180, 331, 421, 675
BspTNI	GGTCTC	2 cut(s)	35, 142
BsrDI	GCAATG	1 cut(s)	217
BssMI	GATC	1 cut(s)	373
Bst6I	CTCTTC	1 cut(s)	64
BstC8I	GCNNGC	1 cut(s)	595
BstF5I	GGATG	3 cut(s)	421, 664, 670
BstKTI	GATC	1 cut(s)	376
BstMAI	GTCTC	3 cut(s)	35, 142, 673
BstMBI	GATC	1 cut(s)	373
BstNSI	RCATGY	1 cut(s)	265
BstV2I	GAAGAC	1 cut(s)	653
BsuRI	GGCC	5 cut(s)	131, 332, 360, 632, 695
BtsCI	GGATG	3 cut(s)	421, 664, 670
Cac8I	GCNNGC	1 cut(s)	595
Cfr13I	GGNCC	4 cut(s)	330, 420, 630, 673
Csp6I	GTAC	4 cut(s)	113, 350, 440, 533
CviAII	CATG	6 cut(s)	97, 203, 254, 262, 362, 634
CviJI	RGCY	9 cut(s)	101, 131, 161, 181, 332, 360, 515, 632, 695
CviKI_1	RGCY	9 cut(s)	101, 131, 161, 181, 332, 360, 515, 632, 695
CviQI	GTAC	4 cut(s)	113, 350, 440, 533
DpnI	GATC	1 cut(s)	375
DpnII	GATC	1 cut(s)	373
EaeI	YGGCCR	2 cut(s)	129, 358
Eam1104I	CTCTTC	1 cut(s)	64
EarI	CTCTTC	1 cut(s)	64
Eco147I	AGGCCT	1 cut(s)	695
Eco31I	GGTCTC	2 cut(s)	35, 142
Eco47I	GGWCC	2 cut(s)	420, 673
FaeI	CATG	6 cut(s)	100, 206, 257, 265, 365, 637
FaqI	GGGAC	1 cut(s)	433
FatI	CATG	6 cut(s)	96, 202, 253, 261, 361, 633
FauNDI	CATATG	1 cut(s)	325
FbaI	TGATCA	1 cut(s)	373
FokI	GGATG	3 cut(s)	428, 671, 677
FspBI	CTAG	5 cut(s)	65, 102, 107, 276, 654
HaeIII	GGCC	5 cut(s)	131, 332, 360, 632, 695
HapII	CCGG	5 cut(s)	176, 423, 447, 516, 540
Hin1II	CATG	6 cut(s)	100, 206, 257, 265, 365, 637
HinfI	GANTC	1 cut(s)	545
HpaII	CCGG	5 cut(s)	176, 423, 447, 516, 540
HphI	GGTGA	3 cut(s)	211, 476, 701
Hpy166II	GTNNAC	1 cut(s)	259
Hpy188I	TCNGA	1 cut(s)	673
Hpy188III	TCNNGA	3 cut(s)	234, 540, 699
Hpy8I	GTNNAC	1 cut(s)	259
HpyAV	CCTTC	3 cut(s)	177, 420, 453
HpyCH4IV	ACGT	1 cut(s)	229
HpyCH4V	TGCA	4 cut(s)	210, 319, 382, 593
HpySE526I	ACGT	1 cut(s)	229
Hsp92II	CATG	6 cut(s)	100, 206, 257, 265, 365, 637
Kpn2I	TCCGGA	1 cut(s)	539
Ksp22I	TGATCA	1 cut(s)	373
Kzo9I	GATC	1 cut(s)	373
LmnI	GCTCC	2 cut(s)	158, 178
LpnPI	CCDG	5 cut(s)	189, 436, 460, 529, 553
MaeI	CTAG	5 cut(s)	65, 102, 107, 276, 654
MaeII	ACGT	1 cut(s)	229
MaeIII	GTNAC	1 cut(s)	469
MalI	GATC	1 cut(s)	375
MboI	GATC	1 cut(s)	373
MboII	GAAGA	7 cut(s)	51, 264, 353, 443, 501, 536, 658
MfeI	CAATTG	1 cut(s)	377
MlsI	TGGCCA	2 cut(s)	131, 360
MluCI	AATT	2 cut(s)	377, 680
MluNI	TGGCCA	2 cut(s)	131, 360
MnlI	CCTC	8 cut(s)	103, 330, 363, 406, 512, 547, 655, 685
Mox20I	TGGCCA	2 cut(s)	131, 360
MroI	TCCGGA	1 cut(s)	539
MroXI	GAANNNNTTC	1 cut(s)	549
MscI	TGGCCA	2 cut(s)	131, 360
MslI	CAYNNNNRTG	2 cut(s)	137, 324
Msp20I	TGGCCA	2 cut(s)	131, 360
MspI	CCGG	5 cut(s)	176, 423, 447, 516, 540
MunI	CAATTG	1 cut(s)	377
Mva1269I	GAATGC	3 cut(s)	212, 319, 484
NdeI	CATATG	1 cut(s)	325
NdeII	GATC	1 cut(s)	373
NlaIII	CATG	6 cut(s)	100, 206, 257, 265, 365, 637
NlaIV	GGNNCC	5 cut(s)	160, 180, 331, 421, 675
NmuCI	GTSAC	1 cut(s)	469
NspI	RCATGY	1 cut(s)	265
PceI	AGGCCT	1 cut(s)	695
PctI	GAATGC	3 cut(s)	212, 319, 484
PdmI	GAANNNNTTC	1 cut(s)	549
PfeI	GAWTC	1 cut(s)	545
PspN4I	GGNNCC	5 cut(s)	160, 180, 331, 421, 675
PspPI	GGNCC	4 cut(s)	330, 420, 630, 673
RsaI	GTAC	4 cut(s)	114, 351, 441, 534
RsaNI	GTAC	4 cut(s)	113, 350, 440, 533
RseI	CAYNNNNRTG	2 cut(s)	137, 324
Sau3AI	GATC	1 cut(s)	373
Sau96I	GGNCC	4 cut(s)	330, 420, 630, 673
SetI	ASST	9 cut(s)	21, 114, 169, 232, 243, 355, 445, 513, 565
SinI	GGWCC	2 cut(s)	420, 673
SmiMI	CAYNNNNRTG	2 cut(s)	137, 324
SmlI	CTYRAG	1 cut(s)	14
SmoI	CTYRAG	1 cut(s)	14
SpeI	ACTAGT	1 cut(s)	64
Sse9I	AATT	2 cut(s)	377, 680
SseBI	AGGCCT	1 cut(s)	695
SsiI	CCGC	1 cut(s)	38
SspMI	CTAG	5 cut(s)	65, 102, 107, 276, 654
StuI	AGGCCT	1 cut(s)	695
TaiI	ACGT	1 cut(s)	232
TasI	AATT	2 cut(s)	377, 680
TfiI	GAWTC	1 cut(s)	545
TseFI	GTSAC	1 cut(s)	469
Tsp45I	GTSAC	1 cut(s)	469
TspDTI	ATGAA	2 cut(s)	219, 312
VpaK11BI	GGWCC	2 cut(s)	420, 673
XceI	RCATGY	1 cut(s)	265
XmnI	GAANNNNTTC	1 cut(s)	549
XspI	CTAG	5 cut(s)	65, 102, 107, 276, 654

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.