Rmu_sc0003882.1_g000025

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003882.1
Physical Location & Seq
Reverse (-)
84841 .. 86144
1304 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003882.1_g000025.1.cds

Sequence Viewer

Length: 1050 bp
atgggagagtttctcaaggttcaaacttctactaatgtggagaccaagcaaagcatatcttcactagttcaagggtatcaaactctacaacaaggcatggctagactagaggtacaagtgggccaaatggccaccaacacgagtgagagaccagaaggagccttaccttcacaaccggagccaaatccaagaggccaaatcagtgaatgcaatgtcattaccactctacgttcgggaaaggtatatgataatcaagtttacatgcccacatcttctagtttccatacaaatcctttatttgatgatgatattgacttgcattcatatggggccaagagggaagaaaatgtacctctttgtcatgttattgatgatcaattgcatatatatcatgattctatttatctcaaggaggatgggatcggaagggaagaaaatgtaccttccgaagctattcttggcaaaagttatggtttcttatcctttgcgaatgatgtgagaaaatatggtttgattgatagtggcaaggaaagagctttattgaaaaagaacacttctagggatgaggatgcttcggcccctaaattagatggtgaggccatgaaggctagggacccatctaaggccaatgacacctctaagaagaaccctagtgggaccgtgactgcccttaggggcatcaccggaagcctcacctttgatccacctcttgatttgaatacatcggagccaccacttccttatcctaatgccgcaagaagagaaaattcaaagaggggtaagaagaagagtgggttgatgagggagatacaagaaatatttaagaaagtggatgtcaatatcccattgatggacctcattcatcaagtgccggtgtatgctcaatttctcaagagcttgtgcatgaacaaaaagaaattcaaagccaatgagacatttgagttgaaggaggaagtaagtgcaaatatccaacgaaggctaccaccaaagatgcaagatatggggagctttactatagggtgtactataggagagaaagtgtttgaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

349

Amino Acids

38.93

Weight (kDa)

6.63

Isoelectric Point (pI)

47.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 753
AclWI GGATC 2 cut(s) 428, 695
AcoI YGGCCR 1 cut(s) 129
AcsI RAATTY 2 cut(s) 766, 917
AfaI GTAC 4 cut(s) 114, 351, 441, 1024
AfiI CCNNNNNNNGG 2 cut(s) 622, 850
AgsI TTSAA 8 cut(s) 23, 71, 544, 718, 771, 922, 946, 1046
AhlI ACTAGT 1 cut(s) 64
AjuI GAANNNNNNNTTGG 2 cut(s) 441, 473
AluBI AGCT 4 cut(s) 452, 536, 897, 1008
AluI AGCT 4 cut(s) 452, 536, 897, 1008
Alw26I GTCTC 3 cut(s) 35, 142, 926
AlwI GGATC 2 cut(s) 428, 695
AoxI GGCC 7 cut(s) 121, 129, 193, 330, 576, 597, 624
ApoI RAATTY 2 cut(s) 766, 917
Asp700I GAANNNNTTC 1 cut(s) 453
AspS9I GGNCC 6 cut(s) 121, 330, 577, 613, 657, 853
AsuHPI GGTGA 3 cut(s) 605, 673, 685
AvaII GGWCC 3 cut(s) 613, 657, 853
AxyI CCTNAGG 1 cut(s) 671
BalI TGGCCA 1 cut(s) 131
BarI GAAGNNNNNNTAC 6 cut(s) 147, 179, 333, 365, 423, 455
BauI CACGAG 1 cut(s) 139
BccI CCATC 4 cut(s) 410, 584, 625, 844
BclI TGATCA 1 cut(s) 373
BcoDI GTCTC 3 cut(s) 35, 142, 926
BcuI ACTAGT 1 cut(s) 64
BfaI CTAG 7 cut(s) 65, 102, 107, 276, 558, 609, 651
BfmI CTRYAG 2 cut(s) 1014, 1026
BglI GCCNNNNNGGC 1 cut(s) 605
BisI GCNGC 1 cut(s) 753
BlsI GCNGC 1 cut(s) 754
Bme18I GGWCC 3 cut(s) 613, 657, 853
BmgT120I GGNCC 6 cut(s) 121, 330, 577, 613, 657, 853
BmiI GGNNCC 8 cut(s) 160, 180, 331, 579, 614, 615, 658, 729
BmsI GCATC 3 cut(s) 559, 687, 981
BplI GAGNNNNNCTC 1 cut(s) 29
BpuEI CTTGAG 2 cut(s) 392, 875
BsaI GGTCTC 2 cut(s) 35, 142
BsaWI WCCGGW 2 cut(s) 175, 683
BsaXI ACNNNNNCTCC 1 cut(s) 1023
Bsc4I CCNNNNNNNGG 2 cut(s) 622, 850
Bse118I RCCGGY 1 cut(s) 871
Bse21I CCTNAGG 1 cut(s) 671
Bse3DI GCAATG 1 cut(s) 217
BseGI GGATG 4 cut(s) 421, 568, 574, 838
BseLI CCNNNNNNNGG 2 cut(s) 622, 850
BseMI GCAATG 1 cut(s) 217
BshFI GGCC 7 cut(s) 123, 131, 195, 332, 578, 599, 626
BsiSI CCGG 3 cut(s) 176, 684, 872
BslFI GGGAC 2 cut(s) 626, 670
BslI CCNNNNNNNGG 2 cut(s) 622, 850
BsmAI GTCTC 3 cut(s) 35, 142, 926
BsmFI GGGAC 2 cut(s) 626, 670
BsmI GAATGC 2 cut(s) 212, 319
BsnI GGCC 7 cut(s) 123, 131, 195, 332, 578, 599, 626
Bso31I GGTCTC 2 cut(s) 35, 142
Bsp143I GATC 3 cut(s) 373, 420, 700
BspACI CCGC 1 cut(s) 753
BspANI GGCC 7 cut(s) 123, 131, 195, 332, 578, 599, 626
BspHI TCATGA 1 cut(s) 391
BspLI GGNNCC 8 cut(s) 160, 180, 331, 579, 614, 615, 658, 729
BspPI GGATC 2 cut(s) 428, 695
BspTNI GGTCTC 2 cut(s) 35, 142
BsrDI GCAATG 1 cut(s) 217
BsrFI RCCGGY 1 cut(s) 871
BssAI RCCGGY 1 cut(s) 871
BssMI GATC 3 cut(s) 373, 420, 700
BssSI CACGAG 1 cut(s) 139
Bst2BI CACGAG 1 cut(s) 139
Bst4CI ACNGT 1 cut(s) 661
Bst6I CTCTTC 2 cut(s) 754, 782
BstDEI CTNAG 3 cut(s) 621, 639, 671
BstF5I GGATG 4 cut(s) 421, 568, 574, 838
BstKTI GATC 3 cut(s) 376, 423, 703
BstMAI GTCTC 3 cut(s) 35, 142, 926
BstMBI GATC 3 cut(s) 373, 420, 700
BstMWI GCNNNNNNNGC 1 cut(s) 605
BstNSI RCATGY 1 cut(s) 265
BstSFI CTRYAG 2 cut(s) 1014, 1026
Bsu36I CCTNAGG 1 cut(s) 671
BsuRI GGCC 7 cut(s) 123, 131, 195, 332, 578, 599, 626
BtsCI GGATG 4 cut(s) 421, 568, 574, 838
BtsIMutI CAGTG 1 cut(s) 208
CciI TCATGA 1 cut(s) 391
Cfr10I RCCGGY 1 cut(s) 871
Cfr13I GGNCC 6 cut(s) 121, 330, 577, 613, 657, 853
Csp6I GTAC 4 cut(s) 113, 350, 440, 1023
CviAII CATG 6 cut(s) 97, 262, 362, 392, 601, 904
CviQI GTAC 4 cut(s) 113, 350, 440, 1023
DdeI CTNAG 3 cut(s) 621, 639, 671
DpnI GATC 3 cut(s) 375, 422, 702
DpnII GATC 3 cut(s) 373, 420, 700
EaeI YGGCCR 1 cut(s) 129
Eam1104I CTCTTC 2 cut(s) 754, 782
EarI CTCTTC 2 cut(s) 754, 782
Eco31I GGTCTC 2 cut(s) 35, 142
Eco47I GGWCC 3 cut(s) 613, 657, 853
Eco81I CCTNAGG 1 cut(s) 671
EcoO109I RGGNCCY 1 cut(s) 613
FaeI CATG 6 cut(s) 100, 265, 365, 395, 604, 907
FalI AAGNNNNNCTT 4 cut(s) 43, 75, 441, 473
FaqI GGGAC 2 cut(s) 626, 670
FatI CATG 6 cut(s) 96, 261, 361, 391, 600, 903
FauNDI CATATG 1 cut(s) 325
FbaI TGATCA 1 cut(s) 373
Fnu4HI GCNGC 1 cut(s) 753
FokI GGATG 4 cut(s) 428, 575, 581, 845
Fsp4HI GCNGC 1 cut(s) 753
FspBI CTAG 7 cut(s) 65, 102, 107, 276, 558, 609, 651
GluI GCNGC 1 cut(s) 753
HaeIII GGCC 7 cut(s) 123, 131, 195, 332, 578, 599, 626
HapII CCGG 3 cut(s) 176, 684, 872
Hin1II CATG 6 cut(s) 100, 265, 365, 395, 604, 907
HinfI GANTC 1 cut(s) 395
HpaII CCGG 3 cut(s) 176, 684, 872
HphI GGTGA 3 cut(s) 605, 673, 685
Hpy166II GTNNAC 2 cut(s) 259, 1023
Hpy188I TCNGA 3 cut(s) 425, 448, 727
Hpy188III TCNNGA 4 cut(s) 234, 392, 710, 892
Hpy8I GTNNAC 2 cut(s) 259, 1023
HpyAV CCTTC 7 cut(s) 149, 177, 420, 453, 598, 940, 969
HpyCH4III ACNGT 1 cut(s) 661
HpyCH4IV ACGT 1 cut(s) 229
HpyCH4V TGCA 6 cut(s) 210, 319, 382, 903, 962, 994
HpyF10VI GCNNNNNNNGC 1 cut(s) 605
HpyF3I CTNAG 3 cut(s) 621, 639, 671
HpySE526I ACGT 1 cut(s) 229
Hsp92II CATG 6 cut(s) 100, 265, 365, 395, 604, 907
KflI GGGWCCC 1 cut(s) 613
Ksp22I TGATCA 1 cut(s) 373
Kzo9I GATC 3 cut(s) 373, 420, 700
LmnI GCTCC 4 cut(s) 158, 178, 727, 1005
LpnPI CCDG 4 cut(s) 165, 189, 697, 885
LweI GCATC 3 cut(s) 559, 687, 981
MaeI CTAG 7 cut(s) 65, 102, 107, 276, 558, 609, 651
MaeII ACGT 1 cut(s) 229
MaeIII GTNAC 1 cut(s) 661
MalI GATC 3 cut(s) 375, 422, 702
MboI GATC 3 cut(s) 373, 420, 700
MboII GAAGA 8 cut(s) 51, 264, 353, 443, 655, 771, 796, 799
MfeI CAATTG 1 cut(s) 377
MlsI TGGCCA 1 cut(s) 131
MluCI AATT 5 cut(s) 377, 584, 766, 884, 917
MluNI TGGCCA 1 cut(s) 131
MmeI TCCRAC 1 cut(s) 994
Mox20I TGGCCA 1 cut(s) 131
MroXI GAANNNNTTC 1 cut(s) 453
MscI TGGCCA 1 cut(s) 131
MseI TTAA 1 cut(s) 822
MslI CAYNNNNRTG 1 cut(s) 324
Msp20I TGGCCA 1 cut(s) 131
MspI CCGG 3 cut(s) 176, 684, 872
MunI CAATTG 1 cut(s) 377
Mva1269I GAATGC 2 cut(s) 212, 319
MwoI GCNNNNNNNGC 1 cut(s) 605
NdeI CATATG 1 cut(s) 325
NdeII GATC 3 cut(s) 373, 420, 700
NlaIII CATG 6 cut(s) 100, 265, 365, 395, 604, 907
NlaIV GGNNCC 8 cut(s) 160, 180, 331, 579, 614, 615, 658, 729
NmuCI GTSAC 1 cut(s) 661
NspI RCATGY 1 cut(s) 265
PagI TCATGA 1 cut(s) 391
PctI GAATGC 2 cut(s) 212, 319
PdmI GAANNNNTTC 1 cut(s) 453
PfeI GAWTC 1 cut(s) 395
PkrI GCNGC 1 cut(s) 754
PpuMI RGGWCCY 1 cut(s) 613
Psp5II RGGWCCY 1 cut(s) 613
PspN4I GGNNCC 8 cut(s) 160, 180, 331, 579, 614, 615, 658, 729
PspPI GGNCC 6 cut(s) 121, 330, 577, 613, 657, 853
PspPPI RGGWCCY 1 cut(s) 613
RsaI GTAC 4 cut(s) 114, 351, 441, 1024
RsaNI GTAC 4 cut(s) 113, 350, 440, 1023
RseI CAYNNNNRTG 1 cut(s) 324
SaqAI TTAA 1 cut(s) 822
SatI GCNGC 1 cut(s) 753
Sau3AI GATC 3 cut(s) 373, 420, 700
Sau96I GGNCC 6 cut(s) 121, 330, 577, 613, 657, 853
SfaNI GCATC 3 cut(s) 559, 687, 981
SfcI CTRYAG 2 cut(s) 1014, 1026
SinI GGWCC 3 cut(s) 613, 657, 853
SmiMI CAYNNNNRTG 1 cut(s) 324
SmlI CTYRAG 3 cut(s) 14, 407, 890
SmoI CTYRAG 3 cut(s) 14, 407, 890
SpeI ACTAGT 1 cut(s) 64
Sse9I AATT 5 cut(s) 377, 584, 766, 884, 917
SsiI CCGC 1 cut(s) 753
SspI AATATT 1 cut(s) 819
SspMI CTAG 7 cut(s) 65, 102, 107, 276, 558, 609, 651
TaaI ACNGT 1 cut(s) 661
TaiI ACGT 1 cut(s) 232
TasI AATT 5 cut(s) 377, 584, 766, 884, 917
TatI WGTACW 1 cut(s) 1022
TauI GCSGC 1 cut(s) 755
TfiI GAWTC 1 cut(s) 395
Tru1I TTAA 1 cut(s) 822
Tru9I TTAA 1 cut(s) 822
TscAI CASTG 1 cut(s) 208
TseFI GTSAC 1 cut(s) 661
Tsp45I GTSAC 1 cut(s) 661
TspDTI ATGAA 4 cut(s) 312, 617, 851, 920
TspRI CASTG 1 cut(s) 208
VpaK11BI GGWCC 3 cut(s) 613, 657, 853
XapI RAATTY 2 cut(s) 766, 917
XceI RCATGY 1 cut(s) 265
XmnI GAANNNNTTC 1 cut(s) 453
XspI CTAG 7 cut(s) 65, 102, 107, 276, 558, 609, 651
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.