Rroxscaffold_2G00129400

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0001407
Physical Location & Seq
Reverse (-)
65268648 .. 65276429
7782 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00129400.1

Sequence Viewer

Length: 825 bp
ATGGCGACTTCTACATCATGTTTGCTTTGTGAGAGTCTAGCACATTCCACTCAAGAGTGTCACTTATCATCCAAGTTTCCGGACTTTATTGAAGAACAAGTGAACCAAGTGGGTAATTTTGTGCCAAGGAACCAAAGAAATGATCCTTACTCTAATACTTATAACCCCGGTTGGAGGAATCATCCCAATTTCTCTTGGAGAGACCAAGGAGGTTCATCTAGTGCATTTCAAGGTGGAAAACAAATCTTTAGAGGTGGCCAAGGTCAAGACTCATCAAATGTTGCTAATTATGGCAATGCACACCAAGGAAGCACTCATTTTTCACAATATGGTCAACATGGACAGCAAGCATATGGGTCTAATTCTCAAGGCCAATCTACCTCAAGTCAAGGATTTCATGGTCAAAACACCCCTCCTGGGTTTACTCAAGGTGTTGGCTATAGTGGTAGCAAGTTTCAAGGCAATCCTACCTCATTTCAAGGCCCCCACCAAGGCGAGAACTACAATTCCCCTCCTATTCTCCAAGGCATTCCTATTCAAGCTCCAAATGAACCAAAGAAGCCTAATTTTGAAGACTTGATGGGAGAGTTTCTCAAGGTTCAAACTTCTACTAATGCGGAGACCAAGCAAAACATCTCTTCACTAGTTCAAGGGTATCAAACTCTACAACAAGGCATGGCTAGACTAGAGGTACAAGTGGGCCAAATGGCCACCAACATGAGTGAGAGACCAAAAGAGCCTTACCTTCACAACCGAGCCAAACCCAAAGAGGAAAACTCCATGAATGCAATGCCATCACCACTCTACGTTCGGGAAAGGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 Retrotrans_gag rve

Protein Analysis

274

Amino Acids

30.23

Weight (kDa)

7.78

Isoelectric Point (pI)

42.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 162
AccIII TCCGGA 1 cut(s) 79
AciI CCGC 1 cut(s) 617
AclWI GGATC 1 cut(s) 137
AcoI YGGCCR 2 cut(s) 256, 708
AfaI GTAC 1 cut(s) 693
AfiI CCNNNNNNNGG 3 cut(s) 174, 417, 491
AgsI TTSAA 8 cut(s) 92, 230, 458, 479, 539, 572, 602, 650
AhlI ACTAGT 1 cut(s) 643
AjnI CCWGG 1 cut(s) 415
AloI GAACNNNNNNTCC 2 cut(s) 491, 523
AluBI AGCT 1 cut(s) 542
AluI AGCT 1 cut(s) 542
Alw26I GTCTC 3 cut(s) 195, 614, 721
AlwI GGATC 1 cut(s) 137
Aor13HI TCCGGA 1 cut(s) 79
AoxI GGCC 5 cut(s) 256, 370, 481, 700, 708
AspS9I GGNCC 2 cut(s) 482, 700
AsuC2I CCSGG 1 cut(s) 168
AsuHPI GGTGA 1 cut(s) 789
BalI TGGCCA 2 cut(s) 258, 710
BbsI GAAGAC 1 cut(s) 579
BccI CCATC 2 cut(s) 574, 802
BciT130I CCWGG 1 cut(s) 417
BcnI CCSGG 1 cut(s) 168
BcoDI GTCTC 3 cut(s) 195, 614, 721
BcuI ACTAGT 1 cut(s) 643
BfaI CTAG 5 cut(s) 38, 219, 644, 681, 686
BfmI CTRYAG 1 cut(s) 439
Bme1390I CCNGG 2 cut(s) 168, 417
BmgT120I GGNCC 2 cut(s) 482, 700
BmiI GGNNCC 2 cut(s) 131, 484
BmrFI CCNGG 2 cut(s) 168, 417
BpiI GAAGAC 1 cut(s) 579
BplI GAGNNNNNCTC 4 cut(s) 576, 608, 761, 793
BpuEI CTTGAG 5 cut(s) 36, 351, 367, 411, 578
BpuMI CCSGG 1 cut(s) 168
BsaI GGTCTC 3 cut(s) 195, 614, 721
BsaJI CCNNGG 8 cut(s) 125, 166, 205, 259, 304, 416, 490, 523
BsaWI WCCGGW 1 cut(s) 79
Bsc4I CCNNNNNNNGG 3 cut(s) 174, 417, 491
Bse3DI GCAATG 2 cut(s) 301, 795
BseAI TCCGGA 1 cut(s) 79
BseBI CCWGG 1 cut(s) 417
BseDI CCNNGG 8 cut(s) 125, 166, 205, 259, 304, 416, 490, 523
BseGI GGATG 2 cut(s) 68, 181
BseLI CCNNNNNNNGG 3 cut(s) 174, 417, 491
BseMI GCAATG 2 cut(s) 301, 795
BshFI GGCC 5 cut(s) 258, 372, 483, 702, 710
BsiSI CCGG 2 cut(s) 80, 168
BslI CCNNNNNNNGG 3 cut(s) 174, 417, 491
BsmAI GTCTC 3 cut(s) 195, 614, 721
BsmI GAATGC 2 cut(s) 528, 790
BsnI GGCC 5 cut(s) 258, 372, 483, 702, 710
Bso31I GGTCTC 3 cut(s) 195, 614, 721
Bsp13I TCCGGA 1 cut(s) 79
Bsp143I GATC 1 cut(s) 142
BspACI CCGC 1 cut(s) 617
BspANI GGCC 5 cut(s) 258, 372, 483, 702, 710
BspEI TCCGGA 1 cut(s) 79
BspLI GGNNCC 2 cut(s) 131, 484
BspPI GGATC 1 cut(s) 137
BspTNI GGTCTC 3 cut(s) 195, 614, 721
BsrDI GCAATG 2 cut(s) 301, 795
BssECI CCNNGG 8 cut(s) 125, 166, 205, 259, 304, 416, 490, 523
BssMI GATC 1 cut(s) 142
BssT1I CCWWGG 6 cut(s) 125, 205, 259, 304, 490, 523
Bst2UI CCWGG 1 cut(s) 417
Bst6I CTCTTC 1 cut(s) 643
BstC8I GCNNGC 1 cut(s) 348
BstF5I GGATG 2 cut(s) 68, 181
BstKTI GATC 1 cut(s) 145
BstMAI GTCTC 3 cut(s) 195, 614, 721
BstMBI GATC 1 cut(s) 142
BstNI CCWGG 1 cut(s) 417
BstSCI CCNGG 2 cut(s) 166, 415
BstSFI CTRYAG 1 cut(s) 439
BstV2I GAAGAC 1 cut(s) 579
BsuRI GGCC 5 cut(s) 258, 372, 483, 702, 710
BtsCI GGATG 2 cut(s) 68, 181
Cac8I GCNNGC 1 cut(s) 348
Cfr13I GGNCC 2 cut(s) 482, 700
Csp6I GTAC 1 cut(s) 692
CviAII CATG 6 cut(s) 18, 338, 398, 676, 718, 781
CviQI GTAC 1 cut(s) 692
DpnI GATC 1 cut(s) 144
DpnII GATC 1 cut(s) 142
EaeI YGGCCR 2 cut(s) 256, 708
Eam1104I CTCTTC 1 cut(s) 643
EarI CTCTTC 1 cut(s) 643
Eco130I CCWWGG 6 cut(s) 125, 205, 259, 304, 490, 523
Eco31I GGTCTC 3 cut(s) 195, 614, 721
EcoO109I RGGNCCY 1 cut(s) 482
EcoRII CCWGG 1 cut(s) 415
EcoT14I CCWWGG 6 cut(s) 125, 205, 259, 304, 490, 523
ErhI CCWWGG 6 cut(s) 125, 205, 259, 304, 490, 523
FaeI CATG 6 cut(s) 21, 341, 401, 679, 721, 784
FatI CATG 6 cut(s) 17, 337, 397, 675, 717, 780
FauNDI CATATG 1 cut(s) 352
FokI GGATG 2 cut(s) 55, 168
FspBI CTAG 5 cut(s) 38, 219, 644, 681, 686
HaeIII GGCC 5 cut(s) 258, 372, 483, 702, 710
HapII CCGG 2 cut(s) 80, 168
Hin1II CATG 6 cut(s) 21, 341, 401, 679, 721, 784
HincII GTYRAC 1 cut(s) 335
HindII GTYRAC 1 cut(s) 335
HinfI GANTC 3 cut(s) 34, 178, 269
HpaII CCGG 2 cut(s) 80, 168
HphI GGTGA 1 cut(s) 789
Hpy166II GTNNAC 3 cut(s) 103, 335, 423
Hpy188III TCNNGA 4 cut(s) 53, 80, 266, 812
Hpy8I GTNNAC 3 cut(s) 103, 335, 423
HpyAV CCTTC 1 cut(s) 755
HpyCH4IV ACGT 1 cut(s) 807
HpyCH4V TGCA 3 cut(s) 224, 299, 788
HpySE526I ACGT 1 cut(s) 807
Hsp92II CATG 6 cut(s) 21, 341, 401, 679, 721, 784
Kpn2I TCCGGA 1 cut(s) 79
Kzo9I GATC 1 cut(s) 142
LmnI GCTCC 1 cut(s) 547
LpnPI CCDG 4 cut(s) 93, 181, 402, 429
MaeI CTAG 5 cut(s) 38, 219, 644, 681, 686
MaeII ACGT 1 cut(s) 807
MaeIII GTNAC 1 cut(s) 59
MalI GATC 1 cut(s) 144
MboI GATC 1 cut(s) 142
MboII GAAGA 3 cut(s) 104, 584, 630
MlsI TGGCCA 2 cut(s) 258, 710
MluCI AATT 6 cut(s) 115, 187, 286, 361, 505, 565
MluNI TGGCCA 2 cut(s) 258, 710
MlyI GAGTC 2 cut(s) 43, 263
MmeI TCCRAC 1 cut(s) 152
MnlI CCTC 9 cut(s) 168, 203, 245, 391, 423, 481, 522, 682, 763
Mox20I TGGCCA 2 cut(s) 258, 710
MroI TCCGGA 1 cut(s) 79
MscI TGGCCA 2 cut(s) 258, 710
MslI CAYNNNNRTG 1 cut(s) 716
Msp20I TGGCCA 2 cut(s) 258, 710
MspI CCGG 2 cut(s) 80, 168
MspR9I CCNGG 2 cut(s) 168, 417
Mva1269I GAATGC 2 cut(s) 528, 790
MvaI CCWGG 1 cut(s) 417
NciI CCSGG 1 cut(s) 168
NdeI CATATG 1 cut(s) 352
NdeII GATC 1 cut(s) 142
NlaIII CATG 6 cut(s) 21, 341, 401, 679, 721, 784
NlaIV GGNNCC 2 cut(s) 131, 484
NmuCI GTSAC 1 cut(s) 59
PctI GAATGC 2 cut(s) 528, 790
PfeI GAWTC 1 cut(s) 178
PleI GAGTC 2 cut(s) 42, 263
PpsI GAGTC 2 cut(s) 42, 263
PsiI TTATAA 1 cut(s) 162
Psp6I CCWGG 1 cut(s) 415
PspGI CCWGG 1 cut(s) 415
PspN4I GGNNCC 2 cut(s) 131, 484
PspPI GGNCC 2 cut(s) 482, 700
RsaI GTAC 1 cut(s) 693
RsaNI GTAC 1 cut(s) 692
RseI CAYNNNNRTG 1 cut(s) 716
Sau3AI GATC 1 cut(s) 142
Sau96I GGNCC 2 cut(s) 482, 700
SchI GAGTC 2 cut(s) 43, 263
ScrFI CCNGG 2 cut(s) 168, 417
SfcI CTRYAG 1 cut(s) 439
SmiMI CAYNNNNRTG 1 cut(s) 716
SmlI CTYRAG 5 cut(s) 51, 366, 382, 426, 593
SmoI CTYRAG 5 cut(s) 51, 366, 382, 426, 593
SpeI ACTAGT 1 cut(s) 643
Sse9I AATT 6 cut(s) 115, 187, 286, 361, 505, 565
SsiI CCGC 1 cut(s) 617
SspMI CTAG 5 cut(s) 38, 219, 644, 681, 686
StyD4I CCNGG 2 cut(s) 166, 415
StyI CCWWGG 6 cut(s) 125, 205, 259, 304, 490, 523
TaiI ACGT 1 cut(s) 810
TasI AATT 6 cut(s) 115, 187, 286, 361, 505, 565
TfiI GAWTC 1 cut(s) 178
TseFI GTSAC 1 cut(s) 59
Tsp45I GTSAC 1 cut(s) 59
TspDTI ATGAA 4 cut(s) 204, 386, 564, 797
XspI CTAG 5 cut(s) 38, 219, 644, 681, 686
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.