Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004431.1

Orthogroup ID

OG0001407

Physical Location & Seq

Genomic Coordinates Forward (+)

31844 .. 32137

Gene Structure 294 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004431.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 294 bp

atgggcagattgccaaaagaaagaaataagggggtggataaggtagctggaggggaagaaaatgtacccttcggaggtgctattctttgtcgtggttatggtttcttgtcctttgaaaatgatacatataagtatgctttgattggtaatggtaaagaaagagctttgttgaggaagaatacttctagggatgaggatatctcggatcctagattagatggtgaggccatgaaggctagggacccatctaaggtcgatgacacctctaggaaggttcttgatgatattatatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

97

Amino Acids

10.76

Weight (kDa)

6.29

Isoelectric Point (pI)

19.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001407)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g10250 FvH4_4g10250 FvH4_6g21790
rosa_chinensis	RchiOBHm_Chr2g0133891 RchiOBHm_Chr3g0452821 RchiOBHm_Chr3g0452831 RchiOBHm_Chr5g0042701 RchiOBHm_Chr5g0080601 RchiOBHm_Chr6g0279391
rosa_multiflora	Rmu_co8061076.1_g000001 Rmu_co8477889.1_g000001 Rmu_co8492139.1_g000002 Rmu_sc0000083.1_g000025 Rmu_sc0000084.1_g000033 Rmu_sc0000239.1_g000083 Rmu_sc0000427.1_g000012 Rmu_sc0000677.1_g000017 Rmu_sc0000684.1_g000015 Rmu_sc0000893.1_g000006 Rmu_sc0001047.1_g000017 Rmu_sc0001124.1_g000001 Rmu_sc0001353.1_g000052 Rmu_sc0001575.1_g000031 Rmu_sc0001687.1_g000017 Rmu_sc0002083.1_g000017 Rmu_sc0002083.1_g000018 Rmu_sc0002319.1_g000002 Rmu_sc0002385.1_g000007 Rmu_sc0002472.1_g000033 Rmu_sc0002564.1_g000008 Rmu_sc0002564.1_g000009 Rmu_sc0002702.1_g000010 Rmu_sc0003499.1_g000003 Rmu_sc0003527.1_g000011 Rmu_sc0003882.1_g000025 Rmu_sc0003882.1_g000047 Rmu_sc0004191.1_g000027 Rmu_sc0004431.1_g000007 Rmu_sc0005670.1_g000007 Rmu_sc0006954.1_g000001 Rmu_sc0008128.1_g000002 Rmu_sc0012865.1_g000004 Rmu_sc0013815.1_g000001 Rmu_sc0017745.1_g000001 Rmu_ssc0000350.1_g000007
rosa_roxburghii	Rroxscaffold_1G00030490 Rroxscaffold_2G00129400 Rroxscaffold_3G00218530 Rroxscaffold_4G00320090 Rroxscaffold_4G00322270
rosa_samantha	Rh1CG054500 Rh5BG351400
rosa_wichuraiana	Rw5G029510

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	200, 213
AfaI	GTAC	1 cut(s)	66
AfiI	CCNNNNNNNGG	2 cut(s)	74, 250
AgsI	TTSAA	1 cut(s)	116
AluBI	AGCT	2 cut(s)	47, 164
AluI	AGCT	2 cut(s)	47, 164
AlwI	GGATC	2 cut(s)	200, 213
AoxI	GGCC	1 cut(s)	225
AspS9I	GGNCC	1 cut(s)	241
AsuHPI	GGTGA	1 cut(s)	233
AvaII	GGWCC	1 cut(s)	241
BamHI	GGATCC	1 cut(s)	205
BarI	GAAGNNNNNNTAC	2 cut(s)	48, 80
BccI	CCATC	2 cut(s)	212, 253
BfaI	CTAG	4 cut(s)	186, 210, 237, 267
BglI	GCCNNNNNGGC	1 cut(s)	233
Bme18I	GGWCC	1 cut(s)	241
BmgT120I	GGNCC	1 cut(s)	241
BmiI	GGNNCC	3 cut(s)	207, 242, 243
BplI	GAGNNNNNCTC	2 cut(s)	185, 217
BpmI	CTGGAG	1 cut(s)	69
Bsc4I	CCNNNNNNNGG	2 cut(s)	74, 250
BseGI	GGATG	1 cut(s)	196
BseLI	CCNNNNNNNGG	2 cut(s)	74, 250
BshFI	GGCC	1 cut(s)	227
BslFI	GGGAC	1 cut(s)	254
BslI	CCNNNNNNNGG	2 cut(s)	74, 250
BsmFI	GGGAC	1 cut(s)	254
BsnI	GGCC	1 cut(s)	227
Bsp143I	GATC	1 cut(s)	205
BspANI	GGCC	1 cut(s)	227
BspLI	GGNNCC	3 cut(s)	207, 242, 243
BspPI	GGATC	2 cut(s)	200, 213
BssMI	GATC	1 cut(s)	205
BstDEI	CTNAG	1 cut(s)	249
BstF5I	GGATG	1 cut(s)	196
BstKTI	GATC	1 cut(s)	208
BstMBI	GATC	1 cut(s)	205
BstMWI	GCNNNNNNNGC	1 cut(s)	233
BstX2I	RGATCY	1 cut(s)	205
BstYI	RGATCY	1 cut(s)	205
BsuRI	GGCC	1 cut(s)	227
BtsCI	GGATG	1 cut(s)	196
Cfr13I	GGNCC	1 cut(s)	241
Csp6I	GTAC	1 cut(s)	65
CviAII	CATG	1 cut(s)	229
CviJI	RGCY	4 cut(s)	47, 164, 227, 236
CviKI_1	RGCY	4 cut(s)	47, 164, 227, 236
CviQI	GTAC	1 cut(s)	65
DdeI	CTNAG	1 cut(s)	249
DpnI	GATC	1 cut(s)	207
DpnII	GATC	1 cut(s)	205
Eco32I	GATATC	1 cut(s)	199
Eco47I	GGWCC	1 cut(s)	241
EcoO109I	RGGNCCY	1 cut(s)	241
EcoRV	GATATC	1 cut(s)	199
FaeI	CATG	1 cut(s)	232
FaiI	YATR	7 cut(s)	99, 127, 129, 135, 230, 290, 292
FaqI	GGGAC	1 cut(s)	254
FatI	CATG	1 cut(s)	228
FokI	GGATG	1 cut(s)	203
FspBI	CTAG	4 cut(s)	186, 210, 237, 267
GsuI	CTGGAG	1 cut(s)	69
HaeIII	GGCC	1 cut(s)	227
Hin1II	CATG	1 cut(s)	232
HphI	GGTGA	1 cut(s)	233
Hpy188I	TCNGA	2 cut(s)	74, 205
Hpy188III	TCNNGA	1 cut(s)	278
HpyAV	CCTTC	3 cut(s)	79, 226, 265
HpyF10VI	GCNNNNNNNGC	1 cut(s)	233
HpyF3I	CTNAG	1 cut(s)	249
Hsp92II	CATG	1 cut(s)	232
KflI	GGGWCCC	1 cut(s)	241
Kzo9I	GATC	1 cut(s)	205
LpnPI	CCDG	1 cut(s)	33
MaeI	CTAG	4 cut(s)	186, 210, 237, 267
MalI	GATC	1 cut(s)	207
MboI	GATC	1 cut(s)	205
MboII	GAAGA	2 cut(s)	68, 187
MflI	RGATCY	1 cut(s)	205
MnlI	CCTC	6 cut(s)	44, 68, 165, 187, 217, 274
MwoI	GCNNNNNNNGC	1 cut(s)	233
NdeII	GATC	1 cut(s)	205
NlaIII	CATG	1 cut(s)	232
NlaIV	GGNNCC	3 cut(s)	207, 242, 243
PpuMI	RGGWCCY	1 cut(s)	241
Psp5II	RGGWCCY	1 cut(s)	241
PspN4I	GGNNCC	3 cut(s)	207, 242, 243
PspPI	GGNCC	1 cut(s)	241
PspPPI	RGGWCCY	1 cut(s)	241
PsuI	RGATCY	1 cut(s)	205
RsaI	GTAC	1 cut(s)	66
RsaNI	GTAC	1 cut(s)	65
Sau3AI	GATC	1 cut(s)	205
Sau96I	GGNCC	1 cut(s)	241
SetI	ASST	7 cut(s)	45, 49, 79, 166, 255, 266, 276
SinI	GGWCC	1 cut(s)	241
SspMI	CTAG	4 cut(s)	186, 210, 237, 267
TaqI	TCGA	1 cut(s)	255
TspDTI	ATGAA	1 cut(s)	245
VpaK11BI	GGWCC	1 cut(s)	241
XspI	CTAG	4 cut(s)	186, 210, 237, 267

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.