Rmu_sc0002564.1_g000008

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002564.1
OG0001407
Physical Location & Seq
Forward (+)
44994 .. 45758
765 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002564.1_g000008.1.cds

Sequence Viewer

Length: 765 bp
atgagagagttcctcaaggttcaaacttctactaatgcggagaccaagcaaaacatctcttcactagttcaagggtatcaaactctacaacaaggcatggctagactagaggtacaagtgggccaaatggccaccaatatgagtgagagaccaaaaggggccttaccttcacaaccggagccaaacccaagaggaaaacttcatgaatgcaatgtcatcaccactctacgttcgggaaaggtatatgataatcatgtttacatgcctacatcttctagtttccatacaaatcctttatttgatgacgatgttgatttgcattcatatggggccaagagggaagaaaatgtacctcttggccatgttgttgatgatcaattgcatacatatcatgattctttttatcataaggaggatgagaccggaagggaagaaaatgtaccttccggtaaatatggagtgggtgatgtgactttgaatgccaaaggaagaaataagggggtggataaggtagccggaggggaagaaaatgtaccctccggagaatctattcttggtaaaggttatggtttcttgtcctttgagaacaatgcaagcaaatatggtttgattgatagtggcaaagaaagggccatgagggatgaggatgtctcggaccctaaattagaaggtgaggccatcaaggctagggacccatctacggccgataacacctctaggaaggttcttgatgacattagacccaccactacccaccactcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 Retrotrans_gag rve

Protein Analysis

254

Amino Acids

28.06

Weight (kDa)

5.59

Isoelectric Point (pI)

37.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 539
AciI CCGC 1 cut(s) 38
AcoI YGGCCR 3 cut(s) 129, 358, 702
AfaI GTAC 4 cut(s) 114, 351, 441, 534
AfiI CCNNNNNNNGG 1 cut(s) 700
AgsI TTSAA 3 cut(s) 23, 71, 478
AhlI ACTAGT 1 cut(s) 64
AjuI GAANNNNNNNTTGG 2 cut(s) 537, 569
Alw26I GTCTC 4 cut(s) 35, 142, 413, 655
Aor13HI TCCGGA 1 cut(s) 539
AoxI GGCC 8 cut(s) 121, 129, 159, 330, 358, 630, 675, 702
Asp700I GAANNNNTTC 1 cut(s) 549
AspS9I GGNCC 6 cut(s) 121, 159, 330, 630, 655, 691
AsuHPI GGTGA 3 cut(s) 211, 476, 683
AvaII GGWCC 2 cut(s) 655, 691
BalI TGGCCA 2 cut(s) 131, 360
BarI GAAGNNNNNNTAC 6 cut(s) 333, 365, 423, 455, 516, 548
BccI CCATC 2 cut(s) 686, 703
BceAI ACGGC 1 cut(s) 717
BclI TGATCA 1 cut(s) 373
BcoDI GTCTC 4 cut(s) 35, 142, 413, 655
BcuI ACTAGT 1 cut(s) 64
BfaI CTAG 6 cut(s) 65, 102, 107, 276, 687, 717
BglI GCCNNNNNGGC 1 cut(s) 683
Bme18I GGWCC 2 cut(s) 655, 691
BmgT120I GGNCC 6 cut(s) 121, 159, 330, 630, 655, 691
BmiI GGNNCC 6 cut(s) 160, 180, 331, 657, 692, 693
BplI GAGNNNNNCTC 3 cut(s) 29, 635, 667
BsaI GGTCTC 3 cut(s) 35, 142, 413
BsaWI WCCGGW 4 cut(s) 175, 422, 446, 539
Bsc4I CCNNNNNNNGG 1 cut(s) 700
Bse3DI GCAATG 1 cut(s) 217
BseAI TCCGGA 1 cut(s) 539
BseGI GGATG 3 cut(s) 421, 646, 652
BseLI CCNNNNNNNGG 1 cut(s) 700
BseMI GCAATG 1 cut(s) 217
BseX3I CGGCCG 1 cut(s) 702
Bsh1285I CGRYCG 1 cut(s) 705
BshFI GGCC 8 cut(s) 123, 131, 161, 332, 360, 632, 677, 704
BsiEI CGRYCG 1 cut(s) 705
BsiSI CCGG 5 cut(s) 176, 423, 447, 516, 540
BslFI GGGAC 1 cut(s) 704
BslI CCNNNNNNNGG 1 cut(s) 700
BsmAI GTCTC 4 cut(s) 35, 142, 413, 655
BsmFI GGGAC 1 cut(s) 704
BsmI GAATGC 3 cut(s) 212, 319, 484
BsnI GGCC 8 cut(s) 123, 131, 161, 332, 360, 632, 677, 704
Bso31I GGTCTC 3 cut(s) 35, 142, 413
Bsp13I TCCGGA 1 cut(s) 539
Bsp143I GATC 1 cut(s) 373
BspACI CCGC 1 cut(s) 38
BspANI GGCC 8 cut(s) 123, 131, 161, 332, 360, 632, 677, 704
BspEI TCCGGA 1 cut(s) 539
BspHI TCATGA 3 cut(s) 202, 391, 761
BspLI GGNNCC 6 cut(s) 160, 180, 331, 657, 692, 693
BspTNI GGTCTC 3 cut(s) 35, 142, 413
BsrDI GCAATG 1 cut(s) 217
BssMI GATC 1 cut(s) 373
Bst6I CTCTTC 1 cut(s) 64
BstC8I GCNNGC 1 cut(s) 595
BstF5I GGATG 3 cut(s) 421, 646, 652
BstKTI GATC 1 cut(s) 376
BstMAI GTCTC 4 cut(s) 35, 142, 413, 655
BstMBI GATC 1 cut(s) 373
BstMCI CGRYCG 1 cut(s) 705
BstMWI GCNNNNNNNGC 1 cut(s) 683
BstNSI RCATGY 1 cut(s) 265
BstZI CGGCCG 1 cut(s) 702
BsuRI GGCC 8 cut(s) 123, 131, 161, 332, 360, 632, 677, 704
BtsCI GGATG 3 cut(s) 421, 646, 652
Cac8I GCNNGC 1 cut(s) 595
CciI TCATGA 3 cut(s) 202, 391, 761
Cfr13I GGNCC 6 cut(s) 121, 159, 330, 630, 655, 691
Csp6I GTAC 4 cut(s) 113, 350, 440, 533
CviAII CATG 8 cut(s) 97, 203, 254, 262, 362, 392, 634, 762
CviQI GTAC 4 cut(s) 113, 350, 440, 533
DpnI GATC 1 cut(s) 375
DpnII GATC 1 cut(s) 373
EaeI YGGCCR 3 cut(s) 129, 358, 702
EagI CGGCCG 1 cut(s) 702
Eam1104I CTCTTC 1 cut(s) 64
EarI CTCTTC 1 cut(s) 64
EclXI CGGCCG 1 cut(s) 702
Eco31I GGTCTC 3 cut(s) 35, 142, 413
Eco47I GGWCC 2 cut(s) 655, 691
Eco52I CGGCCG 1 cut(s) 702
EcoO109I RGGNCCY 2 cut(s) 159, 691
FaeI CATG 8 cut(s) 100, 206, 257, 265, 365, 395, 637, 765
FaqI GGGAC 1 cut(s) 704
FatI CATG 8 cut(s) 96, 202, 253, 261, 361, 391, 633, 761
FauNDI CATATG 1 cut(s) 325
FbaI TGATCA 1 cut(s) 373
FokI GGATG 3 cut(s) 428, 653, 659
FspBI CTAG 6 cut(s) 65, 102, 107, 276, 687, 717
HaeIII GGCC 8 cut(s) 123, 131, 161, 332, 360, 632, 677, 704
HapII CCGG 5 cut(s) 176, 423, 447, 516, 540
Hin1II CATG 8 cut(s) 100, 206, 257, 265, 365, 395, 637, 765
HinfI GANTC 2 cut(s) 395, 545
HpaII CCGG 5 cut(s) 176, 423, 447, 516, 540
HphI GGTGA 3 cut(s) 211, 476, 683
Hpy166II GTNNAC 1 cut(s) 259
Hpy188I TCNGA 1 cut(s) 655
Hpy188III TCNNGA 6 cut(s) 203, 234, 392, 540, 728, 762
Hpy8I GTNNAC 1 cut(s) 259
HpyAV CCTTC 5 cut(s) 177, 420, 453, 662, 715
HpyCH4IV ACGT 1 cut(s) 229
HpyCH4V TGCA 4 cut(s) 210, 319, 382, 593
HpyF10VI GCNNNNNNNGC 1 cut(s) 683
HpySE526I ACGT 1 cut(s) 229
Hsp92II CATG 8 cut(s) 100, 206, 257, 265, 365, 395, 637, 765
KflI GGGWCCC 1 cut(s) 691
Kpn2I TCCGGA 1 cut(s) 539
Ksp22I TGATCA 1 cut(s) 373
Kzo9I GATC 1 cut(s) 373
LmnI GCTCC 1 cut(s) 178
LpnPI CCDG 5 cut(s) 189, 436, 460, 529, 553
MaeI CTAG 6 cut(s) 65, 102, 107, 276, 687, 717
MaeII ACGT 1 cut(s) 229
MaeIII GTNAC 1 cut(s) 469
MalI GATC 1 cut(s) 375
MboI GATC 1 cut(s) 373
MboII GAAGA 6 cut(s) 51, 264, 353, 443, 501, 536
MfeI CAATTG 1 cut(s) 377
MlsI TGGCCA 2 cut(s) 131, 360
MluCI AATT 2 cut(s) 377, 662
MluNI TGGCCA 2 cut(s) 131, 360
Mox20I TGGCCA 2 cut(s) 131, 360
MroI TCCGGA 1 cut(s) 539
MroXI GAANNNNTTC 1 cut(s) 549
MscI TGGCCA 2 cut(s) 131, 360
MslI CAYNNNNRTG 2 cut(s) 137, 324
Msp20I TGGCCA 2 cut(s) 131, 360
MspI CCGG 5 cut(s) 176, 423, 447, 516, 540
MunI CAATTG 1 cut(s) 377
Mva1269I GAATGC 3 cut(s) 212, 319, 484
MwoI GCNNNNNNNGC 1 cut(s) 683
NdeI CATATG 1 cut(s) 325
NdeII GATC 1 cut(s) 373
NlaIII CATG 8 cut(s) 100, 206, 257, 265, 365, 395, 637, 765
NlaIV GGNNCC 6 cut(s) 160, 180, 331, 657, 692, 693
NmuCI GTSAC 1 cut(s) 469
NspI RCATGY 1 cut(s) 265
PagI TCATGA 3 cut(s) 202, 391, 761
PctI GAATGC 3 cut(s) 212, 319, 484
PdmI GAANNNNTTC 1 cut(s) 549
PfeI GAWTC 2 cut(s) 395, 545
PpuMI RGGWCCY 1 cut(s) 691
Psp5II RGGWCCY 1 cut(s) 691
PspN4I GGNNCC 6 cut(s) 160, 180, 331, 657, 692, 693
PspPI GGNCC 6 cut(s) 121, 159, 330, 630, 655, 691
PspPPI RGGWCCY 1 cut(s) 691
RsaI GTAC 4 cut(s) 114, 351, 441, 534
RsaNI GTAC 4 cut(s) 113, 350, 440, 533
RseI CAYNNNNRTG 2 cut(s) 137, 324
Sau3AI GATC 1 cut(s) 373
Sau96I GGNCC 6 cut(s) 121, 159, 330, 630, 655, 691
SinI GGWCC 2 cut(s) 655, 691
SmiMI CAYNNNNRTG 2 cut(s) 137, 324
SmlI CTYRAG 1 cut(s) 14
SmoI CTYRAG 1 cut(s) 14
SpeI ACTAGT 1 cut(s) 64
Sse9I AATT 2 cut(s) 377, 662
SsiI CCGC 1 cut(s) 38
SspMI CTAG 6 cut(s) 65, 102, 107, 276, 687, 717
TaiI ACGT 1 cut(s) 232
TasI AATT 2 cut(s) 377, 662
TfiI GAWTC 2 cut(s) 395, 545
TseFI GTSAC 1 cut(s) 469
Tsp45I GTSAC 1 cut(s) 469
TspDTI ATGAA 3 cut(s) 191, 219, 312
VpaK11BI GGWCC 2 cut(s) 655, 691
XceI RCATGY 1 cut(s) 265
XmnI GAANNNNTTC 1 cut(s) 549
XspI CTAG 6 cut(s) 65, 102, 107, 276, 687, 717
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.