Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004191.1

Orthogroup ID

OG0001407

Physical Location & Seq

Genomic Coordinates Reverse (-)

103823 .. 104272

Gene Structure 450 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004191.1_g000027.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 450 bp

atgttgagaaagaacacttctaggaatgaggatatctcggattctagattagatgatgaggccatgaaggcaagggacccatctaaggccattgacacctctaggaaggttcttaatgacattagacccactcctaatgagtttgagacatctgcttcaagagaaaatgaggggaggaataaggaggaagacctacatgttcatagtagctctagggataggagttgtccggtctattcatcactaggcggggccttgaaggctaagaatcctagtgcgaccgtgactacccttaggggcaccactagaagtctcacctttgatccacctcttgatttgagtacatcggagcctcaacttccctaccctaatgtgccaagaaaggaaaatgtgaagaatgataggaagaagaagaaagttggtttgatgtccgaatgcatgatattttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

149

Amino Acids

16.75

Weight (kDa)

9.14

Isoelectric Point (pI)

58.62

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001407)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g10250 FvH4_4g10250 FvH4_6g21790
rosa_chinensis	RchiOBHm_Chr2g0133891 RchiOBHm_Chr3g0452821 RchiOBHm_Chr3g0452831 RchiOBHm_Chr5g0042701 RchiOBHm_Chr5g0080601 RchiOBHm_Chr6g0279391
rosa_multiflora	Rmu_co8061076.1_g000001 Rmu_co8477889.1_g000001 Rmu_co8492139.1_g000002 Rmu_sc0000083.1_g000025 Rmu_sc0000084.1_g000033 Rmu_sc0000239.1_g000083 Rmu_sc0000427.1_g000012 Rmu_sc0000677.1_g000017 Rmu_sc0000684.1_g000015 Rmu_sc0000893.1_g000006 Rmu_sc0001047.1_g000017 Rmu_sc0001124.1_g000001 Rmu_sc0001353.1_g000052 Rmu_sc0001575.1_g000031 Rmu_sc0001687.1_g000017 Rmu_sc0002083.1_g000017 Rmu_sc0002083.1_g000018 Rmu_sc0002319.1_g000002 Rmu_sc0002385.1_g000007 Rmu_sc0002472.1_g000033 Rmu_sc0002564.1_g000008 Rmu_sc0002564.1_g000009 Rmu_sc0002702.1_g000010 Rmu_sc0003499.1_g000003 Rmu_sc0003527.1_g000011 Rmu_sc0003882.1_g000025 Rmu_sc0003882.1_g000047 Rmu_sc0004191.1_g000027 Rmu_sc0004431.1_g000007 Rmu_sc0005670.1_g000007 Rmu_sc0006954.1_g000001 Rmu_sc0008128.1_g000002 Rmu_sc0012865.1_g000004 Rmu_sc0013815.1_g000001 Rmu_sc0017745.1_g000001 Rmu_ssc0000350.1_g000007
rosa_roxburghii	Rroxscaffold_1G00030490 Rroxscaffold_2G00129400 Rroxscaffold_3G00218530 Rroxscaffold_4G00320090 Rroxscaffold_4G00322270
rosa_samantha	Rh1CG054500 Rh5BG351400
rosa_wichuraiana	Rw5G029510

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	299
AciI	CCGC	1 cut(s)	249
AclWI	GGATC	1 cut(s)	317
AfaI	GTAC	1 cut(s)	343
AfiI	CCNNNNNNNGG	1 cut(s)	85
AflIII	ACRYGT	1 cut(s)	196
AgsI	TTSAA	2 cut(s)	159, 259
AluBI	AGCT	1 cut(s)	210
AluI	AGCT	1 cut(s)	210
Alw26I	GTCTC	2 cut(s)	140, 317
AlwI	GGATC	1 cut(s)	317
AoxI	GGCC	3 cut(s)	60, 87, 252
AspS9I	GGNCC	2 cut(s)	76, 252
AsuHPI	GGTGA	1 cut(s)	307
AvaII	GGWCC	1 cut(s)	76
AxyI	CCTNAGG	1 cut(s)	293
BaeGI	GKGCMC	1 cut(s)	302
BanI	GGYRCC	1 cut(s)	299
BbsI	GAAGAC	1 cut(s)	195
BccI	CCATC	1 cut(s)	88
BcoDI	GTCTC	2 cut(s)	140, 317
BfaI	CTAG	7 cut(s)	21, 45, 102, 213, 245, 273, 306
BglI	GCCNNNNNGGC	2 cut(s)	68, 260
Bme18I	GGWCC	1 cut(s)	76
BmgT120I	GGNCC	2 cut(s)	76, 252
BmiI	GGNNCC	5 cut(s)	77, 78, 253, 301, 351
BpiI	GAAGAC	1 cut(s)	195
BplI	GAGNNNNNCTC	2 cut(s)	20, 52
BsaWI	WCCGGW	1 cut(s)	229
Bsc4I	CCNNNNNNNGG	1 cut(s)	85
Bse21I	CCTNAGG	1 cut(s)	293
BseLI	CCNNNNNNNGG	1 cut(s)	85
BseSI	GKGCMC	1 cut(s)	302
Bsh1285I	CGRYCG	1 cut(s)	282
BshFI	GGCC	3 cut(s)	62, 89, 254
BshNI	GGYRCC	1 cut(s)	299
BsiEI	CGRYCG	1 cut(s)	282
BsiSI	CCGG	1 cut(s)	230
BslFI	GGGAC	1 cut(s)	89
BslI	CCNNNNNNNGG	1 cut(s)	85
BsmAI	GTCTC	2 cut(s)	140, 317
BsmFI	GGGAC	1 cut(s)	89
BsmI	GAATGC	1 cut(s)	440
BsnI	GGCC	3 cut(s)	62, 89, 254
Bsp1286I	GDGCHC	1 cut(s)	302
Bsp143I	GATC	1 cut(s)	322
BspACI	CCGC	1 cut(s)	249
BspANI	GGCC	3 cut(s)	62, 89, 254
BspLI	GGNNCC	5 cut(s)	77, 78, 253, 301, 351
BspPI	GGATC	1 cut(s)	317
BspT107I	GGYRCC	1 cut(s)	299
BssMI	GATC	1 cut(s)	322
Bst4CI	ACNGT	1 cut(s)	283
BstDEI	CTNAG	3 cut(s)	84, 264, 293
BstKTI	GATC	1 cut(s)	325
BstMAI	GTCTC	2 cut(s)	140, 317
BstMBI	GATC	1 cut(s)	322
BstMCI	CGRYCG	1 cut(s)	282
BstMWI	GCNNNNNNNGC	2 cut(s)	68, 260
BstNSI	RCATGY	1 cut(s)	200
BstSLI	GKGCMC	1 cut(s)	302
BstV2I	GAAGAC	1 cut(s)	195
Bsu36I	CCTNAGG	1 cut(s)	293
BsuRI	GGCC	3 cut(s)	62, 89, 254
Cfr13I	GGNCC	2 cut(s)	76, 252
Csp6I	GTAC	1 cut(s)	342
CviAII	CATG	3 cut(s)	64, 197, 439
CviJI	RGCY	6 cut(s)	62, 89, 210, 254, 263, 352
CviKI_1	RGCY	6 cut(s)	62, 89, 210, 254, 263, 352
CviQI	GTAC	1 cut(s)	342
DdeI	CTNAG	3 cut(s)	84, 264, 293
DpnI	GATC	1 cut(s)	324
DpnII	GATC	1 cut(s)	322
Eco32I	GATATC	1 cut(s)	34
Eco47I	GGWCC	1 cut(s)	76
Eco81I	CCTNAGG	1 cut(s)	293
EcoO109I	RGGNCCY	2 cut(s)	76, 252
EcoRV	GATATC	1 cut(s)	34
EcoT22I	ATGCAT	1 cut(s)	440
FaeI	CATG	3 cut(s)	67, 200, 442
FaiI	YATR	4 cut(s)	65, 198, 204, 440
FaqI	GGGAC	1 cut(s)	89
FatI	CATG	3 cut(s)	63, 196, 438
FauI	CCCGC	1 cut(s)	242
FspBI	CTAG	7 cut(s)	21, 45, 102, 213, 245, 273, 306
HaeIII	GGCC	3 cut(s)	62, 89, 254
HapII	CCGG	1 cut(s)	230
Hin1II	CATG	3 cut(s)	67, 200, 442
HinfI	GANTC	2 cut(s)	41, 268
HpaII	CCGG	1 cut(s)	230
HphI	GGTGA	1 cut(s)	307
Hpy188I	TCNGA	3 cut(s)	40, 349, 433
Hpy188III	TCNNGA	3 cut(s)	45, 159, 332
HpyAV	CCTTC	3 cut(s)	61, 100, 253
HpyCH4III	ACNGT	1 cut(s)	283
HpyCH4V	TGCA	1 cut(s)	438
HpyF10VI	GCNNNNNNNGC	2 cut(s)	68, 260
HpyF3I	CTNAG	3 cut(s)	84, 264, 293
Hsp92II	CATG	3 cut(s)	67, 200, 442
KflI	GGGWCCC	1 cut(s)	76
Kzo9I	GATC	1 cut(s)	322
LmnI	GCTCC	1 cut(s)	349
LpnPI	CCDG	1 cut(s)	243
MaeI	CTAG	7 cut(s)	21, 45, 102, 213, 245, 273, 306
MaeIII	GTNAC	1 cut(s)	283
MalI	GATC	1 cut(s)	324
MboI	GATC	1 cut(s)	322
MboII	GAAGA	5 cut(s)	200, 406, 418, 421, 424
MhlI	GDGCHC	1 cut(s)	302
MnlI	CCTC	8 cut(s)	22, 52, 109, 163, 168, 178, 339, 363
Mph1103I	ATGCAT	1 cut(s)	440
MseI	TTAA	1 cut(s)	114
MspI	CCGG	1 cut(s)	230
Mva1269I	GAATGC	1 cut(s)	440
MwoI	GCNNNNNNNGC	2 cut(s)	68, 260
NdeII	GATC	1 cut(s)	322
NlaIII	CATG	3 cut(s)	67, 200, 442
NlaIV	GGNNCC	5 cut(s)	77, 78, 253, 301, 351
NmuCI	GTSAC	1 cut(s)	283
NsiI	ATGCAT	1 cut(s)	440
NspI	RCATGY	1 cut(s)	200
PciI	ACATGT	1 cut(s)	196
PctI	GAATGC	1 cut(s)	440
PfeI	GAWTC	2 cut(s)	41, 268
PpuMI	RGGWCCY	1 cut(s)	76
PscI	ACATGT	1 cut(s)	196
Psp5II	RGGWCCY	1 cut(s)	76
PspN4I	GGNNCC	5 cut(s)	77, 78, 253, 301, 351
PspPI	GGNCC	2 cut(s)	76, 252
PspPPI	RGGWCCY	1 cut(s)	76
RsaI	GTAC	1 cut(s)	343
RsaNI	GTAC	1 cut(s)	342
SaqAI	TTAA	1 cut(s)	114
Sau3AI	GATC	1 cut(s)	322
Sau96I	GGNCC	2 cut(s)	76, 252
SduI	GDGCHC	1 cut(s)	302
SetI	ASST	6 cut(s)	101, 111, 195, 212, 320, 331
SinI	GGWCC	1 cut(s)	76
SsiI	CCGC	1 cut(s)	249
SspMI	CTAG	7 cut(s)	21, 45, 102, 213, 245, 273, 306
TaaI	ACNGT	1 cut(s)	283
TatI	WGTACW	1 cut(s)	341
TfiI	GAWTC	2 cut(s)	41, 268
Tru1I	TTAA	1 cut(s)	114
Tru9I	TTAA	1 cut(s)	114
TseFI	GTSAC	1 cut(s)	283
Tsp45I	GTSAC	1 cut(s)	283
TspDTI	ATGAA	3 cut(s)	80, 191, 228
VpaK11BI	GGWCC	1 cut(s)	76
XbaI	TCTAGA	1 cut(s)	44
XceI	RCATGY	1 cut(s)	200
XspI	CTAG	7 cut(s)	21, 45, 102, 213, 245, 273, 306
Zsp2I	ATGCAT	1 cut(s)	440

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.