RchiOBHm_Chr7g0222271

(S)-coclaurine N-methyltransferase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0001406
Physical Location & Seq
Reverse (-)
43568484 .. 43569615
1132 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19892

Sequence Viewer

Length: 444 bp
ATGTACAACGTACGGCACAAAATTAAAAATGGCCATATTGTTCTTGATGTTGGATGTGGATGGGGATCACCATCTCTGTACATTGCACAGAAATATAAGAAGTGCAAGGTTACTGGGATCTGCATTTCAGCAACACATAAGGCTTTTATAGAAGAGCAATGTAGGAATCGTCAGCTGGAGAATGTGAAGATCATTATTGCAGATATCAGCACATTTGAGATAGAGGCATCATATGACAGAATATTTTGTTCGAAATGTTTGAGGATGATGTTTCTTTTGTCAATCATTGGCTTGTCAATGGGAAGCATTATGCACAAACAAGGTAAAATTAAACCTTCTTTGCAAACATCTTATTCTCAAGTTTATTGGCATGCCTCGGATACTAAACACAGCCGAAAACCCTTTTGTCTTTGCAGTGAAGAATGGCTGAAAAGAATGGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CMAS

Protein Analysis

147

Amino Acids

16.97

Weight (kDa)

9.32

Isoelectric Point (pI)

50.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CMAS PF02353 7 - 81 1.4e-10 Mycolic acid cyclopropane synthetase
GidB PF02527 8 - 83 2e-07 rRNA small subunit methyltransferase G
Methyltransf_31 PF13847 9 - 110 1.9e-10 Methyltransferase domain
MTS PF05175 11 - 83 7.8e-06 Methyltransferase small domain
TehB PF03848 12 - 92 1.4e-06 Tellurite resistance protein TehB
Methyltransf_25 PF13649 14 - 89 1.9e-12 Methyltransferase domain
Methyltransf_11 PF08241 15 - 88 1.1e-08 Methyltransferase domain
Methyltransf_12 PF08242 15 - 88 7.2e-06 Methyltransferase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 73, 125
AcoI YGGCCR 1 cut(s) 31
AfaI GTAC 3 cut(s) 5, 12, 80
AluBI AGCT 1 cut(s) 175
AluI AGCT 1 cut(s) 175
AlwI GGATC 2 cut(s) 73, 125
AoxI GGCC 1 cut(s) 31
AsuHPI GGTGA 1 cut(s) 60
AsuII TTCGAA 1 cut(s) 251
BalI TGGCCA 1 cut(s) 33
BccI CCATC 2 cut(s) 54, 79
BceAI ACGGC 1 cut(s) 29
BciVI GTATCC 1 cut(s) 373
BfaI CTAG 1 cut(s) 442
BfuI GTATCC 1 cut(s) 373
BmrI ACTGGG 1 cut(s) 123
BmsI GCATC 1 cut(s) 236
BmuI ACTGGG 1 cut(s) 123
BpmI CTGGAG 1 cut(s) 197
Bpu14I TTCGAA 1 cut(s) 251
BpuEI CTTGAG 1 cut(s) 342
BsaBI GATNNNNATC 2 cut(s) 64, 70
BsaJI CCNNGG 1 cut(s) 375
Bse1I ACTGG 1 cut(s) 118
Bse3DI GCAATG 2 cut(s) 81, 164
Bse8I GATNNNNATC 2 cut(s) 64, 70
BseDI CCNNGG 1 cut(s) 375
BseGI GGATG 3 cut(s) 59, 65, 270
BseJI GATNNNNATC 2 cut(s) 64, 70
BseMI GCAATG 2 cut(s) 81, 164
BseNI ACTGG 1 cut(s) 118
BshFI GGCC 1 cut(s) 33
BsiWI CGTACG 1 cut(s) 10
BsnI GGCC 1 cut(s) 33
Bsp119I TTCGAA 1 cut(s) 251
Bsp1407I TGTACA 2 cut(s) 3, 78
Bsp143I GATC 3 cut(s) 65, 117, 189
BspANI GGCC 1 cut(s) 33
BspPI GGATC 2 cut(s) 73, 125
BspQI GCTCTTC 1 cut(s) 147
BspT104I TTCGAA 1 cut(s) 251
BsrDI GCAATG 2 cut(s) 81, 164
BsrGI TGTACA 2 cut(s) 3, 78
BsrI ACTGG 1 cut(s) 118
BssECI CCNNGG 1 cut(s) 375
BssMI GATC 3 cut(s) 65, 117, 189
Bst6I CTCTTC 1 cut(s) 147
BstAUI TGTACA 2 cut(s) 3, 78
BstBI TTCGAA 1 cut(s) 251
BstC8I GCNNGC 1 cut(s) 372
BstF5I GGATG 3 cut(s) 59, 65, 270
BstKTI GATC 3 cut(s) 68, 120, 192
BstMBI GATC 3 cut(s) 65, 117, 189
BstNSI RCATGY 1 cut(s) 374
BstX2I RGATCY 1 cut(s) 117
BstYI RGATCY 1 cut(s) 117
BsuI GTATCC 1 cut(s) 373
BsuRI GGCC 1 cut(s) 33
BtsCI GGATG 3 cut(s) 59, 65, 270
BtsI GCAGTG 1 cut(s) 421
BtsIMutI CAGTG 1 cut(s) 421
Cac8I GCNNGC 1 cut(s) 372
Csp6I GTAC 3 cut(s) 4, 11, 79
CviAII CATG 1 cut(s) 371
CviJI RGCY 6 cut(s) 33, 143, 175, 291, 393, 427
CviKI_1 RGCY 6 cut(s) 33, 143, 175, 291, 393, 427
CviQI GTAC 3 cut(s) 4, 11, 79
DpnI GATC 3 cut(s) 67, 119, 191
DpnII GATC 3 cut(s) 65, 117, 189
EaeI YGGCCR 1 cut(s) 31
Eam1104I CTCTTC 1 cut(s) 147
EarI CTCTTC 1 cut(s) 147
Eco32I GATATC 1 cut(s) 205
EcoRV GATATC 1 cut(s) 205
FaeI CATG 1 cut(s) 374
FaiI YATR 8 cut(s) 36, 96, 138, 149, 232, 234, 311, 372
FatI CATG 1 cut(s) 370
FauNDI CATATG 1 cut(s) 232
FokI GGATG 3 cut(s) 66, 72, 277
FspBI CTAG 1 cut(s) 442
GsuI CTGGAG 1 cut(s) 197
HaeIII GGCC 1 cut(s) 33
Hin1II CATG 1 cut(s) 374
HinfI GANTC 1 cut(s) 166
HphI GGTGA 1 cut(s) 60
Hpy188I TCNGA 1 cut(s) 379
Hpy188III TCNNGA 1 cut(s) 44
HpyAV CCTTC 1 cut(s) 345
HpyCH4IV ACGT 1 cut(s) 9
HpyCH4V TGCA 7 cut(s) 86, 105, 123, 200, 313, 343, 414
HpySE526I ACGT 1 cut(s) 9
Hsp92II CATG 1 cut(s) 374
Kzo9I GATC 3 cut(s) 65, 117, 189
LguI GCTCTTC 1 cut(s) 147
LpnPI CCDG 2 cut(s) 99, 161
LweI GCATC 1 cut(s) 236
MaeI CTAG 1 cut(s) 442
MaeII ACGT 1 cut(s) 9
MaeIII GTNAC 1 cut(s) 109
MalI GATC 3 cut(s) 67, 119, 191
MboI GATC 3 cut(s) 65, 117, 189
MboII GAAGA 3 cut(s) 164, 199, 431
MflI RGATCY 1 cut(s) 117
MlsI TGGCCA 1 cut(s) 33
MluCI AATT 2 cut(s) 21, 327
MluNI TGGCCA 1 cut(s) 33
MmeI TCCRAC 1 cut(s) 31
MnlI CCTC 3 cut(s) 217, 255, 385
Mox20I TGGCCA 1 cut(s) 33
MscI TGGCCA 1 cut(s) 33
MseI TTAA 2 cut(s) 24, 330
Msp20I TGGCCA 1 cut(s) 33
MspA1I CMGCKG 1 cut(s) 175
NdeI CATATG 1 cut(s) 232
NdeII GATC 3 cut(s) 65, 117, 189
NlaIII CATG 1 cut(s) 374
NspI RCATGY 1 cut(s) 374
NspV TTCGAA 1 cut(s) 251
PaeI GCATGC 1 cut(s) 374
PciSI GCTCTTC 1 cut(s) 147
PfeI GAWTC 1 cut(s) 166
Pfl23II CGTACG 1 cut(s) 10
PspLI CGTACG 1 cut(s) 10
PsuI RGATCY 1 cut(s) 117
PvuII CAGCTG 1 cut(s) 175
RsaI GTAC 3 cut(s) 5, 12, 80
RsaNI GTAC 3 cut(s) 4, 11, 79
SapI GCTCTTC 1 cut(s) 147
SaqAI TTAA 2 cut(s) 24, 330
Sau3AI GATC 3 cut(s) 65, 117, 189
SetI ASST 5 cut(s) 12, 111, 177, 325, 337
SfaNI GCATC 1 cut(s) 236
SfuI TTCGAA 1 cut(s) 251
SgeI CNNG 9 cut(s) 56, 118, 126, 188, 304, 332, 371, 383, 388
SmlI CTYRAG 1 cut(s) 357
SmoI CTYRAG 1 cut(s) 357
SphI GCATGC 1 cut(s) 374
Sse9I AATT 2 cut(s) 21, 327
SspI AATATT 1 cut(s) 243
SspMI CTAG 1 cut(s) 442
TaiI ACGT 1 cut(s) 12
TaqI TCGA 1 cut(s) 251
TasI AATT 2 cut(s) 21, 327
TatI WGTACW 2 cut(s) 3, 78
TfiI GAWTC 1 cut(s) 166
Tru1I TTAA 2 cut(s) 24, 330
Tru9I TTAA 2 cut(s) 24, 330
TscAI CASTG 1 cut(s) 421
TspRI CASTG 1 cut(s) 421
XceI RCATGY 1 cut(s) 374
XspI CTAG 1 cut(s) 442
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.