Rmu_sc0011277.1_g000007

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011277.1
OG0001406
Physical Location & Seq
Forward (+)
15679 .. 18429
2751 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011277.1_g000007.1.cds

Sequence Viewer

Length: 1035 bp
ctgagctcctccgacctcgatcgctgcccagaagaggtttgggactcctccggcctccctccggccagccccgcgcctcagtggcctcctggaaccgcctgctgcgtggacgtccgcactttagcgaaagcgggtcttgcagtgttgcaggatgatcagtggtttttggtgggtaggatactcggccccatggaaaagtatccagggttcaagggaactatctcaaccatttggaggatcaagaatggcttattgatccaagaggtgggggatcaatttgtctttcaattcgatcgtgaggctgaacgaaatagggtcctacatggagggccatggttctacaggaacactatgctggttctgggggtgtatgatggggttggatcggtggctgagatcccattaaacctagtggagacatgggtggcagttaaagggctgtcggtgggtttgcgtaacaaggcggctttgaacctgattggatctactataggtcgggttataaaactcgacaacaccgctctgttccggaaggaagaagaacaaaggatccatgcagcgacggttatggcgagggtgtctttggctgatgacactcattggactgaagcggctccaaagcagaatgatttggtagagatgcctttgcttcagttagattcgattgggtgctttgcttgtcagacgggtggggacatcatgctccctttggcggttctcaaatccactagggcagagggtcggggtaagactataatcgtggaaactggccctagcgtagtagtgaggatgaaaagaaactcggtggagatgctggaacgtgtggggaagaggtatggttccaaaacggaacccttacttcaggggaggaaagctaagaagtggaggctgcgcgagagtgacaaatatatccaaactcctgtggaggaggagatggatggtaatgtggaacaagctcaaattgtggaggccccaaagggaggagaagtggatggggtggttgagttatccttatctcctaccataaatgtttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00230 ko00670 ko01100 ko01110 ko01130 ko01523 map00230 map00670 map01100 map01110 map01130 map01523
Pfam Domains
Protein Families
DDE_Tnp_1_7 DUF4283 RVT_1 RVT_3 zf-CCHC_4 zf-RVT

Protein Analysis

344

Amino Acids

37.88

Weight (kDa)

5.85

Isoelectric Point (pI)

36.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 503
AatII GACGTC 1 cut(s) 114
AccB7I CCANNNNNTGG 1 cut(s) 265
AccBSI CCGCTC 1 cut(s) 521
AccII CGCG 2 cut(s) 74, 894
AccIII TCCGGA 1 cut(s) 528
AciI CCGC 8 cut(s) 72, 96, 115, 131, 464, 519, 611, 713
AclWI GGATC 8 cut(s) 245, 250, 279, 391, 391, 490, 544, 557
AcoI YGGCCR 1 cut(s) 63
AcuI CTGAAG 3 cut(s) 627, 635, 845
AcyI GRCGYC 1 cut(s) 111
AfiI CCNNNNNNNGG 6 cut(s) 34, 61, 234, 265, 712, 980
AflIII ACRYGT 1 cut(s) 820
AgsI TTSAA 3 cut(s) 211, 287, 472
AjnI CCWGG 2 cut(s) 88, 202
AloI GAACNNNNNNTCC 2 cut(s) 534, 566
AluBI AGCT 3 cut(s) 6, 875, 956
AluI AGCT 3 cut(s) 6, 875, 956
Alw21I GWGCWC 1 cut(s) 8
Alw26I GTCTC 1 cut(s) 410
AlwI GGATC 8 cut(s) 245, 250, 279, 391, 391, 490, 544, 557
Aor13HI TCCGGA 1 cut(s) 528
AoxI GGCC 7 cut(s) 52, 63, 83, 184, 329, 769, 969
ApeKI GCWGC 4 cut(s) 24, 102, 557, 889
AspLEI GCGC 2 cut(s) 76, 894
AspS9I GGNCC 5 cut(s) 185, 316, 329, 770, 970
AvaII GGWCC 1 cut(s) 316
BamHI GGATCC 1 cut(s) 549
BanII GRGCYC 1 cut(s) 8
Bbv12I GWGCWC 1 cut(s) 8
BbvI GCAGC 4 cut(s) 11, 89, 569, 876
BccI CCATC 4 cut(s) 368, 928, 932, 986
BciT130I CCWGG 2 cut(s) 90, 204
BciVI GTATCC 2 cut(s) 171, 210
BclI TGATCA 1 cut(s) 154
BcoDI GTCTC 1 cut(s) 410
BfaI CTAG 3 cut(s) 410, 729, 774
BfmI CTRYAG 2 cut(s) 340, 489
BfuI GTATCC 2 cut(s) 171, 210
BglI GCCNNNNNGGC 1 cut(s) 82
BisI GCNGC 6 cut(s) 25, 103, 465, 558, 612, 890
BlsI GCNGC 6 cut(s) 26, 104, 466, 559, 613, 891
Bme1390I CCNGG 2 cut(s) 90, 204
Bme18I GGWCC 1 cut(s) 316
BmgT120I GGNCC 5 cut(s) 185, 316, 329, 770, 970
BmiI GGNNCC 8 cut(s) 94, 187, 317, 551, 615, 841, 852, 972
BmrFI CCNGG 2 cut(s) 90, 204
BmsI GCATC 2 cut(s) 630, 801
BsaHI GRCGYC 1 cut(s) 111
BsaJI CCNNGG 3 cut(s) 189, 203, 332
BsaWI WCCGGW 1 cut(s) 528
BsaXI ACNNNNNCTCC 2 cut(s) 972, 1002
Bsc4I CCNNNNNNNGG 6 cut(s) 34, 61, 234, 265, 712, 980
Bse1I ACTGG 1 cut(s) 772
BseAI TCCGGA 1 cut(s) 528
BseBI CCWGG 2 cut(s) 90, 204
BseDI CCNNGG 3 cut(s) 189, 203, 332
BseGI GGATG 4 cut(s) 157, 795, 943, 997
BseLI CCNNNNNNNGG 6 cut(s) 34, 61, 234, 265, 712, 980
BseMII CTCAG 2 cut(s) 92, 384
BseNI ACTGG 1 cut(s) 772
BseRI GAGGAG 4 cut(s) 37, 941, 944, 996
BseXI GCAGC 4 cut(s) 11, 89, 569, 876
Bsh1236I CGCG 2 cut(s) 74, 894
Bsh1285I CGRYCG 2 cut(s) 22, 295
BshFI GGCC 7 cut(s) 54, 65, 85, 186, 331, 771, 971
BsiEI CGRYCG 2 cut(s) 22, 295
BsiHKAI GWGCWC 1 cut(s) 8
BsiSI CCGG 3 cut(s) 51, 62, 529
BslFI GGGAC 2 cut(s) 56, 707
BslI CCNNNNNNNGG 6 cut(s) 34, 61, 234, 265, 712, 980
BsmAI GTCTC 1 cut(s) 410
BsmFI GGGAC 2 cut(s) 56, 707
BsnI GGCC 7 cut(s) 54, 65, 85, 186, 331, 771, 971
Bsp1286I GDGCHC 1 cut(s) 8
Bsp13I TCCGGA 1 cut(s) 528
Bsp19I CCATGG 2 cut(s) 189, 332
BspACI CCGC 8 cut(s) 72, 96, 115, 131, 464, 519, 611, 713
BspANI GGCC 7 cut(s) 54, 65, 85, 186, 331, 771, 971
BspCNI CTCAG 2 cut(s) 91, 385
BspEI TCCGGA 1 cut(s) 528
BspFNI CGCG 2 cut(s) 74, 894
BspLI GGNNCC 8 cut(s) 94, 187, 317, 551, 615, 841, 852, 972
BspPI GGATC 8 cut(s) 245, 250, 279, 391, 391, 490, 544, 557
BsrBI CCGCTC 1 cut(s) 521
BsrI ACTGG 1 cut(s) 772
BssECI CCNNGG 3 cut(s) 189, 203, 332
BssNI GRCGYC 1 cut(s) 111
BssT1I CCWWGG 2 cut(s) 189, 332
Bst2UI CCWGG 2 cut(s) 90, 204
Bst4CI ACNGT 1 cut(s) 565
Bst6I CTCTTC 2 cut(s) 27, 824
BstACI GRCGYC 1 cut(s) 111
BstC8I GCNNGC 2 cut(s) 67, 100
BstDEI CTNAG 4 cut(s) 2, 78, 393, 876
BstDSI CCRYGG 2 cut(s) 189, 332
BstF5I GGATG 4 cut(s) 157, 795, 943, 997
BstFNI CGCG 2 cut(s) 74, 894
BstHHI GCGC 2 cut(s) 76, 894
BstMAI GTCTC 1 cut(s) 410
BstMCI CGRYCG 2 cut(s) 22, 295
BstMWI GCNNNNNNNGC 3 cut(s) 71, 82, 137
BstNI CCWGG 2 cut(s) 90, 204
BstSCI CCNGG 2 cut(s) 88, 202
BstSFI CTRYAG 2 cut(s) 340, 489
BstUI CGCG 2 cut(s) 74, 894
BstV1I GCAGC 4 cut(s) 11, 89, 569, 876
BstX2I RGATCY 3 cut(s) 396, 482, 549
BstYI RGATCY 3 cut(s) 396, 482, 549
BsuI GTATCC 2 cut(s) 171, 210
BsuRI GGCC 7 cut(s) 54, 65, 85, 186, 331, 771, 971
BtgI CCRYGG 2 cut(s) 189, 332
BtsCI GGATG 4 cut(s) 157, 795, 943, 997
BtsI GCAGTG 1 cut(s) 147
BtsIMutI CAGTG 3 cut(s) 86, 147, 164
Cac8I GCNNGC 2 cut(s) 67, 100
CfoI GCGC 2 cut(s) 76, 894
Cfr13I GGNCC 5 cut(s) 185, 316, 329, 770, 970
CviAII CATG 6 cut(s) 190, 323, 333, 420, 554, 700
DdeI CTNAG 4 cut(s) 2, 78, 393, 876
EaeI YGGCCR 1 cut(s) 63
Eam1104I CTCTTC 2 cut(s) 27, 824
EarI CTCTTC 2 cut(s) 27, 824
Ecl136II GAGCTC 1 cut(s) 6
Eco130I CCWWGG 2 cut(s) 189, 332
Eco24I GRGCYC 1 cut(s) 8
Eco47I GGWCC 1 cut(s) 316
Eco53kI GAGCTC 1 cut(s) 6
Eco57I CTGAAG 3 cut(s) 627, 635, 845
EcoICRI GAGCTC 1 cut(s) 6
EcoO109I RGGNCCY 2 cut(s) 316, 970
EcoRII CCWGG 2 cut(s) 88, 202
EcoT14I CCWWGG 2 cut(s) 189, 332
EcoT38I GRGCYC 1 cut(s) 8
ErhI CCWWGG 2 cut(s) 189, 332
FaeI CATG 6 cut(s) 193, 326, 336, 423, 557, 703
FalI AAGNNNNNCTT 4 cut(s) 120, 152, 233, 265
FaqI GGGAC 2 cut(s) 56, 707
FatI CATG 6 cut(s) 189, 322, 332, 419, 553, 699
FauI CCCGC 2 cut(s) 79, 124
FbaI TGATCA 1 cut(s) 154
Fnu4HI GCNGC 6 cut(s) 25, 103, 465, 558, 612, 890
FokI GGATG 4 cut(s) 164, 802, 950, 1004
FriOI GRGCYC 1 cut(s) 8
Fsp4HI GCNGC 6 cut(s) 25, 103, 465, 558, 612, 890
FspBI CTAG 3 cut(s) 410, 729, 774
GlaI GCGC 2 cut(s) 75, 893
GluI GCNGC 6 cut(s) 25, 103, 465, 558, 612, 890
HaeIII GGCC 7 cut(s) 54, 65, 85, 186, 331, 771, 971
HapII CCGG 3 cut(s) 51, 62, 529
HhaI GCGC 2 cut(s) 76, 894
Hin1I GRCGYC 1 cut(s) 111
Hin1II CATG 6 cut(s) 193, 326, 336, 423, 557, 703
Hin6I GCGC 2 cut(s) 74, 892
HinP1I GCGC 2 cut(s) 74, 892
HinfI GANTC 2 cut(s) 44, 659
HpaII CCGG 3 cut(s) 51, 62, 529
Hpy166II GTNNAC 1 cut(s) 109
Hpy188I TCNGA 2 cut(s) 13, 684
Hpy188III TCNNGA 3 cut(s) 241, 296, 529
Hpy8I GTNNAC 1 cut(s) 109
Hpy99I CGWCG 1 cut(s) 565
HpyAV CCTTC 1 cut(s) 526
HpyCH4III ACNGT 1 cut(s) 565
HpyCH4IV ACGT 2 cut(s) 111, 820
HpyCH4V TGCA 3 cut(s) 140, 148, 557
HpyF10VI GCNNNNNNNGC 3 cut(s) 71, 82, 137
HpyF3I CTNAG 4 cut(s) 2, 78, 393, 876
HpySE526I ACGT 2 cut(s) 111, 820
Hsp92I GRCGYC 1 cut(s) 111
Hsp92II CATG 6 cut(s) 193, 326, 336, 423, 557, 703
HspAI GCGC 2 cut(s) 74, 892
Kpn2I TCCGGA 1 cut(s) 528
Ksp22I TGATCA 1 cut(s) 154
LmnI GCTCC 3 cut(s) 11, 619, 708
Lsp1109I GCAGC 4 cut(s) 11, 89, 569, 876
LweI GCATC 2 cut(s) 630, 801
MaeI CTAG 3 cut(s) 410, 729, 774
MaeII ACGT 2 cut(s) 111, 820
MaeIII GTNAC 2 cut(s) 455, 899
MbiI CCGCTC 1 cut(s) 521
MboII GAAGA 4 cut(s) 44, 548, 551, 841
MflI RGATCY 3 cut(s) 396, 482, 549
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 3 cut(s) 275, 287, 960
MlyI GAGTC 1 cut(s) 38
MmeI TCCRAC 2 cut(s) 36, 361
MroI TCCGGA 1 cut(s) 528
MseI TTAA 3 cut(s) 404, 432, 1033
MspI CCGG 3 cut(s) 51, 62, 529
MspR9I CCNGG 2 cut(s) 90, 204
MvaI CCWGG 2 cut(s) 90, 204
MvnI CGCG 2 cut(s) 74, 894
MwoI GCNNNNNNNGC 3 cut(s) 71, 82, 137
NcoI CCATGG 2 cut(s) 189, 332
NlaIII CATG 6 cut(s) 193, 326, 336, 423, 557, 703
NlaIV GGNNCC 8 cut(s) 94, 187, 317, 551, 615, 841, 852, 972
NmeAIII GCCGAG 1 cut(s) 162
NmuCI GTSAC 1 cut(s) 899
PcsI WCGNNNNNNNCGW 1 cut(s) 569
PfeI GAWTC 1 cut(s) 659
PflMI CCANNNNNTGG 1 cut(s) 265
PfoI TCCNGGA 1 cut(s) 88
PkrI GCNGC 6 cut(s) 26, 104, 466, 559, 613, 891
Ple19I CGATCG 2 cut(s) 22, 295
PleI GAGTC 1 cut(s) 38
PpsI GAGTC 1 cut(s) 38
PpuMI RGGWCCY 1 cut(s) 316
PsiI TTATAA 1 cut(s) 503
Psp124BI GAGCTC 1 cut(s) 8
Psp5II RGGWCCY 1 cut(s) 316
Psp6I CCWGG 2 cut(s) 88, 202
PspGI CCWGG 2 cut(s) 88, 202
PspN4I GGNNCC 8 cut(s) 94, 187, 317, 551, 615, 841, 852, 972
PspPI GGNCC 5 cut(s) 185, 316, 329, 770, 970
PspPPI RGGWCCY 1 cut(s) 316
PsrI GAACNNNNNNTAC 2 cut(s) 191, 223
PsuI RGATCY 3 cut(s) 396, 482, 549
PvuI CGATCG 2 cut(s) 22, 295
SacI GAGCTC 1 cut(s) 8
SaqAI TTAA 3 cut(s) 404, 432, 1033
SatI GCNGC 6 cut(s) 25, 103, 465, 558, 612, 890
Sau96I GGNCC 5 cut(s) 185, 316, 329, 770, 970
SchI GAGTC 1 cut(s) 38
ScrFI CCNGG 2 cut(s) 90, 204
SduI GDGCHC 1 cut(s) 8
SfaNI GCATC 2 cut(s) 630, 801
SfcI CTRYAG 2 cut(s) 340, 489
SinI GGWCC 1 cut(s) 316
Sse9I AATT 3 cut(s) 275, 287, 960
SsiI CCGC 8 cut(s) 72, 96, 115, 131, 464, 519, 611, 713
SspMI CTAG 3 cut(s) 410, 729, 774
SstI GAGCTC 1 cut(s) 8
StyD4I CCNGG 2 cut(s) 88, 202
StyI CCWWGG 2 cut(s) 189, 332
TaaI ACNGT 1 cut(s) 565
TaiI ACGT 2 cut(s) 114, 823
TaqI TCGA 4 cut(s) 18, 291, 510, 662
TasI AATT 3 cut(s) 275, 287, 960
TauI GCSGC 2 cut(s) 467, 614
TfiI GAWTC 1 cut(s) 659
Tru1I TTAA 3 cut(s) 404, 432, 1033
Tru9I TTAA 3 cut(s) 404, 432, 1033
TscAI CASTG 3 cut(s) 86, 147, 164
TseFI GTSAC 1 cut(s) 899
TseI GCWGC 4 cut(s) 24, 102, 557, 889
Tsp45I GTSAC 1 cut(s) 899
TspDTI ATGAA 1 cut(s) 806
TspGWI ACGGA 1 cut(s) 863
TspRI CASTG 3 cut(s) 86, 147, 164
Van91I CCANNNNNTGG 1 cut(s) 265
VpaK11BI GGWCC 1 cut(s) 316
XcmI CCANNNNNNNNNTGG 1 cut(s) 36
XspI CTAG 3 cut(s) 410, 729, 774
ZraI GACGTC 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.