Rmu_co8155174.1_g000001

Thaumatin-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8155174.1
OG0000594
Physical Location & Seq
Forward (+)
1 .. 655
655 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8155174.1_g000001.1.cds

Sequence Viewer

Length: 655 bp
tgcaggcgcacatccggcaacaatttctttcacaaacaagtgcgccttcaaggtctggccagcaaccctaacttctgataaaaaacctcagttagcatcgacggggttcgagttagcaccccaagctagcaattccatagacactccggttccatggtctggccgcttctggggccgtaccaactgcttcacggacaatttaggaatgttcacttgtgacaaaccaggggattgcgcatccggtcaggtctcatgcaacggaaaaggaggaattccgccagccacgttggtggaaattaatatcccagcaggtgggggtcaagatttctacgatgttagtcttgttgacggcttcaacttgcccatctccgtaacccctcaaggcggtaacgctcccggggactgtcggagctctagctgcagcgccaacgtgaacgctatgtgtccgagtgagctacaagttacgggggctggcgggagcgtggttggctgcatgagcgcgtgcgtgaagttcaatgagcccaagtattgctgcactccacctaatgaaaagccagagacatgtcctcctacggactactctatgaagtttagtcaacaatgccctgaggcttacagctacgcttatgatgacaagaaaggcacattcacttgc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0006950 GO:0006952 GO:0008150 GO:0050896
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Thaumatin

Protein Analysis

218

Amino Acids

22.88

Weight (kDa)

4.95

Isoelectric Point (pI)

45.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000594)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g04210 FvH4_5g06220 FvH4_6g05880 FvH4_6g16950 FvH4_6g16950 FvH4_6g24670
malus_domestica MD04G1018400.v1.1 MD09G1256000.v1.1 MD09G1256300.v1.1 MD10G1201100.v1.1 MD16G1224000.v1.1 MD17G1249400.v1.1 MD17G1249600.v1.1 MD17G1250000.v1.1
prunus_persica Prupe.1G045400_v2.0.a1 Prupe.3G143900_v2.0.a1 Prupe.3G144000_v2.0.a1 Prupe.3G144100_v2.0.a1 Prupe.3G148300_v2.0.a1 Prupe.4G141100_v2.0.a1 Prupe.7G051100_v2.0.a1 Prupe.7G051200_v2.0.a1 Prupe.7G051500_v2.0.a1 Prupe.7G051500_v2.0.a1
pyrus_communis pycom04g01470 pycom09g13920 pycom09g17210 pycom09g17220 pycom10g17230 pycom17g25380
rosa_chinensis RchiOBHm_Chr1g0358711 RchiOBHm_Chr3g0470981 RchiOBHm_Chr3g0484051 RchiOBHm_Chr3g0484161 RchiOBHm_Chr3g0484171 RchiOBHm_Chr3g0484231
rosa_laevigata RLG00000009673 RLG00000023239 RLG00000023242 RLG00000024216 RLG00000024224 RLG00000027927
rosa_multiflora Rmu_co8155174.1_g000001 Rmu_co8316645.1_g000001 Rmu_co8355789.1_g000001 Rmu_sc0000839.1_g000011 Rmu_sc0002956.1_g000002 Rmu_sc0003477.1_g000008 Rmu_sc0005424.1_g000002 Rmu_sc0011148.1_g000008 Rmu_sc0011191.1_g000001
rosa_roxburghii Rroxscaffold_4G00297660 Rroxscaffold_5G00339700 Rroxscaffold_6G00397850 Rroxscaffold_6G00397880 Rroxscaffold_6G00410340
rosa_rugosa Rorug01G0264600 Rorug03G0114700 Rorug03G0210300 Rorug03G0362500.1
rosa_samantha Rh1AG279000 Rh1BG245600 Rh1DG273900 Rh3AG164200 Rh3AG259100 Rh3BG189700 Rh3BG295400 Rh3BG295700 Rh3CG179700 Rh3CG293100 Rh3DG186500 Rh3DG288800 Rh3DG289200 Rh4AG054300 Rh4BG052000 Rh4CG058900 Rh4DG050600
rosa_wichuraiana Rw1G024760 Rw3G015440 Rw3G023340 Rw4G004330

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 300
Acc16I TGCGCA 1 cut(s) 236
Acc36I ACCTGC 1 cut(s) 300
AccB7I CCANNNNNTGG 2 cut(s) 159, 312
AccII CGCG 1 cut(s) 501
AciI CCGC 4 cut(s) 164, 276, 385, 475
AcoI YGGCCR 2 cut(s) 57, 161
AcsI RAATTY 1 cut(s) 271
AfaI GTAC 1 cut(s) 179
AfiI CCNNNNNNNGG 4 cut(s) 159, 170, 312, 384
AflIII ACRYGT 1 cut(s) 561
AgsI TTSAA 3 cut(s) 50, 356, 515
AjnI CCWGG 1 cut(s) 224
AleI CACNNNNGTG 1 cut(s) 288
AluBI AGCT 5 cut(s) 126, 412, 418, 455, 619
AluI AGCT 5 cut(s) 126, 412, 418, 455, 619
Alw21I GWGCWC 1 cut(s) 414
Alw26I GTCTC 2 cut(s) 254, 552
Ama87I CYCGRG 1 cut(s) 396
AoxI GGCC 3 cut(s) 57, 161, 173
ApeKI GCWGC 4 cut(s) 418, 421, 490, 532
ApoI RAATTY 1 cut(s) 271
AseI ATTAAT 1 cut(s) 298
AspLEI GCGC 5 cut(s) 9, 45, 237, 426, 501
AspS9I GGNCC 1 cut(s) 173
AsuC2I CCSGG 2 cut(s) 397, 398
AsuNHI GCTAGC 1 cut(s) 126
AvaI CYCGRG 1 cut(s) 396
AxyI CCTNAGG 1 cut(s) 607
BalI TGGCCA 1 cut(s) 59
BanII GRGCYC 2 cut(s) 414, 523
Bbv12I GWGCWC 1 cut(s) 414
BbvI GCAGC 4 cut(s) 405, 433, 477, 519
BccI CCATC 1 cut(s) 372
BceAI ACGGC 2 cut(s) 160, 365
BciT130I CCWGG 1 cut(s) 226
BcnI CCSGG 2 cut(s) 397, 398
BcoDI GTCTC 2 cut(s) 254, 552
BfaI CTAG 2 cut(s) 127, 415
BfmI CTRYAG 1 cut(s) 419
BfoI RGCGCY 1 cut(s) 427
BfuAI ACCTGC 1 cut(s) 300
BisI GCNGC 5 cut(s) 164, 419, 422, 491, 533
BlsI GCNGC 5 cut(s) 165, 420, 423, 492, 534
Bme1390I CCNGG 3 cut(s) 226, 397, 398
BmeT110I CYCGRG 1 cut(s) 396
BmgT120I GGNCC 1 cut(s) 173
BmiI GGNNCC 2 cut(s) 151, 174
BmrFI CCNGG 3 cut(s) 226, 397, 398
BmsI GCATC 2 cut(s) 105, 246
BmtI GCTAGC 1 cut(s) 130
BpuEI CTTGAG 1 cut(s) 364
BpuMI CCSGG 2 cut(s) 397, 398
BsaI GGTCTC 1 cut(s) 254
BsaJI CCNNGG 4 cut(s) 153, 225, 396, 397
BsaWI WCCGGW 2 cut(s) 146, 240
BsaXI ACNNNNNCTCC 2 cut(s) 551, 581
Bsc4I CCNNNNNNNGG 4 cut(s) 159, 170, 312, 384
Bse21I CCTNAGG 1 cut(s) 607
BseBI CCWGG 1 cut(s) 226
BseDI CCNNGG 4 cut(s) 153, 225, 396, 397
BseGI GGATG 2 cut(s) 11, 237
BseLI CCNNNNNNNGG 4 cut(s) 159, 170, 312, 384
BseMII CTCAG 2 cut(s) 102, 598
BseXI GCAGC 4 cut(s) 405, 433, 477, 519
BseYI CCCAGC 1 cut(s) 305
BsgI GTGCAG 1 cut(s) 518
Bsh1236I CGCG 1 cut(s) 501
BshFI GGCC 3 cut(s) 59, 163, 175
BsiHKAI GWGCWC 1 cut(s) 414
BsiHKCI CYCGRG 1 cut(s) 396
BsiSI CCGG 4 cut(s) 15, 147, 241, 397
BslFI GGGAC 1 cut(s) 414
BslI CCNNNNNNNGG 4 cut(s) 159, 170, 312, 384
BsmAI GTCTC 2 cut(s) 254, 552
BsmFI GGGAC 1 cut(s) 414
BsnI GGCC 3 cut(s) 59, 163, 175
Bso31I GGTCTC 1 cut(s) 254
BsoBI CYCGRG 1 cut(s) 396
Bsp1286I GDGCHC 2 cut(s) 414, 523
Bsp19I CCATGG 1 cut(s) 153
BspACI CCGC 4 cut(s) 164, 276, 385, 475
BspANI GGCC 3 cut(s) 59, 163, 175
BspCNI CTCAG 2 cut(s) 101, 599
BspFNI CGCG 1 cut(s) 501
BspLI GGNNCC 2 cut(s) 151, 174
BspMAI CTGCAG 1 cut(s) 423
BspMI ACCTGC 1 cut(s) 300
BspOI GCTAGC 1 cut(s) 130
BspTNI GGTCTC 1 cut(s) 254
BssECI CCNNGG 4 cut(s) 153, 225, 396, 397
BssT1I CCWWGG 1 cut(s) 153
Bst2UI CCWGG 1 cut(s) 226
Bst4CI ACNGT 1 cut(s) 405
BstC8I GCNNGC 6 cut(s) 5, 61, 128, 280, 473, 503
BstDEI CTNAG 2 cut(s) 88, 607
BstDSI CCRYGG 1 cut(s) 153
BstF5I GGATG 2 cut(s) 11, 237
BstFNI CGCG 1 cut(s) 501
BstH2I RGCGCY 1 cut(s) 427
BstHHI GCGC 5 cut(s) 9, 45, 237, 426, 501
BstMAI GTCTC 2 cut(s) 254, 552
BstMWI GCNNNNNNNGC 6 cut(s) 15, 123, 172, 418, 487, 496
BstNI CCWGG 1 cut(s) 226
BstNSI RCATGY 1 cut(s) 565
BstSCI CCNGG 3 cut(s) 224, 395, 396
BstSFI CTRYAG 1 cut(s) 419
BstUI CGCG 1 cut(s) 501
BstV1I GCAGC 4 cut(s) 405, 433, 477, 519
BstXI CCANNNNNNTGG 1 cut(s) 290
Bsu36I CCTNAGG 1 cut(s) 607
BsuRI GGCC 3 cut(s) 59, 163, 175
BtgI CCRYGG 1 cut(s) 153
BtsCI GGATG 2 cut(s) 11, 237
BveI ACCTGC 1 cut(s) 300
Cac8I GCNNGC 6 cut(s) 5, 61, 128, 280, 473, 503
CfoI GCGC 5 cut(s) 9, 45, 237, 426, 501
Cfr13I GGNCC 1 cut(s) 173
Cfr9I CCCGGG 1 cut(s) 396
Csp6I GTAC 1 cut(s) 178
CviAII CATG 4 cut(s) 154, 253, 494, 562
CviQI GTAC 1 cut(s) 178
DdeI CTNAG 2 cut(s) 88, 607
EaeI YGGCCR 2 cut(s) 57, 161
EciI GGCGGA 1 cut(s) 265
Ecl136II GAGCTC 1 cut(s) 412
Eco130I CCWWGG 1 cut(s) 153
Eco24I GRGCYC 2 cut(s) 414, 523
Eco31I GGTCTC 1 cut(s) 254
Eco53kI GAGCTC 1 cut(s) 412
Eco81I CCTNAGG 1 cut(s) 607
Eco88I CYCGRG 1 cut(s) 396
EcoICRI GAGCTC 1 cut(s) 412
EcoRI GAATTC 1 cut(s) 271
EcoRII CCWGG 1 cut(s) 224
EcoT14I CCWWGG 1 cut(s) 153
EcoT38I GRGCYC 2 cut(s) 414, 523
ErhI CCWWGG 1 cut(s) 153
FaeI CATG 4 cut(s) 157, 256, 497, 565
FaiI YATR 8 cut(s) 138, 155, 254, 441, 495, 563, 585, 628
FalI AAGNNNNNCTT 2 cut(s) 30, 62
FaqI GGGAC 1 cut(s) 414
FatI CATG 4 cut(s) 153, 252, 493, 561
FauI CCCGC 1 cut(s) 468
Fnu4HI GCNGC 5 cut(s) 164, 419, 422, 491, 533
FokI GGATG 1 cut(s) 224
FriOI GRGCYC 2 cut(s) 414, 523
Fsp4HI GCNGC 5 cut(s) 164, 419, 422, 491, 533
FspBI CTAG 2 cut(s) 127, 415
FspI TGCGCA 1 cut(s) 236
GlaI GCGC 5 cut(s) 8, 44, 236, 425, 500
GluI GCNGC 5 cut(s) 164, 419, 422, 491, 533
GsaI CCCAGC 1 cut(s) 309
HaeII RGCGCY 1 cut(s) 427
HaeIII GGCC 3 cut(s) 59, 163, 175
HapII CCGG 4 cut(s) 15, 147, 241, 397
HhaI GCGC 5 cut(s) 9, 45, 237, 426, 501
Hin1II CATG 4 cut(s) 157, 256, 497, 565
Hin6I GCGC 5 cut(s) 7, 43, 235, 424, 499
HinP1I GCGC 5 cut(s) 7, 43, 235, 424, 499
HincII GTYRAC 2 cut(s) 347, 597
HindII GTYRAC 2 cut(s) 347, 597
HpaII CCGG 4 cut(s) 15, 147, 241, 397
Hpy166II GTNNAC 4 cut(s) 211, 347, 434, 597
Hpy188I TCNGA 3 cut(s) 77, 409, 448
Hpy188III TCNNGA 1 cut(s) 321
Hpy8I GTNNAC 4 cut(s) 211, 347, 434, 597
Hpy99I CGWCG 1 cut(s) 104
HpyAV CCTTC 1 cut(s) 56
HpyCH4III ACNGT 1 cut(s) 405
HpyCH4IV ACGT 2 cut(s) 285, 430
HpyCH4V TGCA 5 cut(s) 3, 256, 421, 493, 535
HpyF10VI GCNNNNNNNGC 6 cut(s) 15, 123, 172, 418, 487, 496
HpyF3I CTNAG 2 cut(s) 88, 607
HpySE526I ACGT 2 cut(s) 285, 430
Hsp92II CATG 4 cut(s) 157, 256, 497, 565
HspAI GCGC 5 cut(s) 7, 43, 235, 424, 499
LmnI GCTCC 3 cut(s) 398, 409, 478
Lsp1109I GCAGC 4 cut(s) 405, 433, 477, 519
LweI GCATC 2 cut(s) 105, 246
MaeI CTAG 2 cut(s) 127, 415
MaeII ACGT 2 cut(s) 285, 430
MaeIII GTNAC 4 cut(s) 216, 371, 387, 461
MhlI GDGCHC 2 cut(s) 414, 523
MlsI TGGCCA 1 cut(s) 59
MluCI AATT 5 cut(s) 22, 131, 197, 271, 295
MluNI TGGCCA 1 cut(s) 59
MmeI TCCRAC 1 cut(s) 387
MnlI CCTC 5 cut(s) 97, 261, 388, 577, 602
Mox20I TGGCCA 1 cut(s) 59
MscI TGGCCA 1 cut(s) 59
MseI TTAA 1 cut(s) 298
MslI CAYNNNNRTG 1 cut(s) 288
Msp20I TGGCCA 1 cut(s) 59
MspI CCGG 4 cut(s) 15, 147, 241, 397
MspR9I CCNGG 3 cut(s) 226, 397, 398
MvaI CCWGG 1 cut(s) 226
MvnI CGCG 1 cut(s) 501
MwoI GCNNNNNNNGC 6 cut(s) 15, 123, 172, 418, 487, 496
NciI CCSGG 2 cut(s) 397, 398
NcoI CCATGG 1 cut(s) 153
NheI GCTAGC 1 cut(s) 126
NlaIII CATG 4 cut(s) 157, 256, 497, 565
NlaIV GGNNCC 2 cut(s) 151, 174
NmuCI GTSAC 1 cut(s) 216
NsbI TGCGCA 1 cut(s) 236
NspI RCATGY 1 cut(s) 565
OliI CACNNNNGTG 1 cut(s) 288
PaqCI CACCTGC 1 cut(s) 300
PciI ACATGT 1 cut(s) 561
PflMI CCANNNNNTGG 2 cut(s) 159, 312
PkrI GCNGC 5 cut(s) 165, 420, 423, 492, 534
PscI ACATGT 1 cut(s) 561
PshBI ATTAAT 1 cut(s) 298
Psp124BI GAGCTC 1 cut(s) 414
Psp6I CCWGG 1 cut(s) 224
PspFI CCCAGC 1 cut(s) 305
PspGI CCWGG 1 cut(s) 224
PspN4I GGNNCC 2 cut(s) 151, 174
PspPI GGNCC 1 cut(s) 173
PstI CTGCAG 1 cut(s) 423
RsaI GTAC 1 cut(s) 179
RsaNI GTAC 1 cut(s) 178
RseI CAYNNNNRTG 1 cut(s) 288
SacI GAGCTC 1 cut(s) 414
SaqAI TTAA 1 cut(s) 298
SatI GCNGC 5 cut(s) 164, 419, 422, 491, 533
Sau96I GGNCC 1 cut(s) 173
ScrFI CCNGG 3 cut(s) 226, 397, 398
SduI GDGCHC 2 cut(s) 414, 523
SfaNI GCATC 2 cut(s) 105, 246
SfcI CTRYAG 1 cut(s) 419
SmaI CCCGGG 1 cut(s) 398
SmiMI CAYNNNNRTG 1 cut(s) 288
SmlI CTYRAG 1 cut(s) 379
SmoI CTYRAG 1 cut(s) 379
Sse9I AATT 5 cut(s) 22, 131, 197, 271, 295
SsiI CCGC 4 cut(s) 164, 276, 385, 475
SspMI CTAG 2 cut(s) 127, 415
SstI GAGCTC 1 cut(s) 414
StyD4I CCNGG 3 cut(s) 224, 395, 396
StyI CCWWGG 1 cut(s) 153
TaaI ACNGT 1 cut(s) 405
TaiI ACGT 2 cut(s) 288, 433
TaqI TCGA 2 cut(s) 99, 109
TasI AATT 5 cut(s) 22, 131, 197, 271, 295
TauI GCSGC 1 cut(s) 166
Tru1I TTAA 1 cut(s) 298
Tru9I TTAA 1 cut(s) 298
TseFI GTSAC 1 cut(s) 216
TseI GCWGC 4 cut(s) 418, 421, 490, 532
Tsp45I GTSAC 1 cut(s) 216
TspDTI ATGAA 2 cut(s) 562, 600
TspGWI ACGGA 4 cut(s) 207, 274, 359, 588
TspMI CCCGGG 1 cut(s) 396
Van91I CCANNNNNTGG 2 cut(s) 159, 312
VspI ATTAAT 1 cut(s) 298
XapI RAATTY 1 cut(s) 271
XceI RCATGY 1 cut(s) 565
XmaI CCCGGG 1 cut(s) 396
XspI CTAG 2 cut(s) 127, 415
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.