Rmu_co8503549.1_g000001

Mitogen-activated protein kinase kinase kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8503549.1
OG0001271
Physical Location & Seq
Forward (+)
1 .. 2373
2373 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8503549.1_g000001.1.cds

Sequence Viewer

Length: 859 bp
agaaactggggccttgtgtgcaatgaaggaagttgatctcattcctgatgatcctaaatctgcagaaagtataaagcaattggagcaggaaattaaagtcctccgtacactaaagcatccaaatattgtgcagtactatggtagtgaagtgattgatgatcatttctacatatatttagaatatgttcaccccggatcaataaataaatatgtccgagaccatattggagctatgactgaatccgtaatccgcaattttacccgccatatcctctgtgggttggcttttttgcatgacacgaagacaattcacagggatattaaaggtgcaaatttgctcgttgatgcatcaggcgttgtcaaacttgccgattttgggatggcaaaacatcttggtgcgcattcatacaatctttctttgaagggcagcccatactggatggctcctgaggtcataaaggctgtgatacagaatgatggtgatcctaatcttgctttggctgttgatatatggagcttgggttgtaccatcattgagatgttcaatggaaaaccgccttggagtgaatttgaagggccacaagctatgttcaaggttctgcacagaaccccggatataccagaaaaattatctgcagaaggaaaggaattcctcagtttgtgcttcaaaaggaaccccgcagagaggccatcagctaagaagctacttgatcatccttttgtacgaaattcaaatgatcaaaatgtctcatcttatactcgggctttttctctggtaatggataaattgaatagcccgacggaccatattaagcaaaaacttgatcgaatgctggtctgtccacgcacttctaattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04010 ko04011 ko04139 ko04722 ko04912 ko05166 map04010 map04011 map04139 map04722 map04912 map05166
Pfam Domains
Protein Families
Pkinase

Protein Analysis

285

Amino Acids

32.13

Weight (kDa)

6.95

Isoelectric Point (pI)

28.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 400
AciI CCGC 4 cut(s) 251, 263, 555, 679
AclWI GGATC 3 cut(s) 45, 203, 477
AcsI RAATTY 4 cut(s) 332, 567, 648, 728
AfaI GTAC 4 cut(s) 107, 135, 527, 724
AfiI CCNNNNNNNGG 2 cut(s) 376, 685
AgsI TTSAA 7 cut(s) 422, 545, 573, 593, 668, 733, 791
AjuI GAANNNNNNNTTGG 2 cut(s) 542, 574
AluBI AGCT 5 cut(s) 231, 517, 585, 696, 704
AluI AGCT 5 cut(s) 231, 517, 585, 696, 704
Alw26I GTCTC 2 cut(s) 211, 752
AlwI GGATC 3 cut(s) 45, 203, 477
Ama87I CYCGRG 1 cut(s) 760
AoxI GGCC 3 cut(s) 10, 576, 687
ApeKI GCWGC 1 cut(s) 427
ApoI RAATTY 4 cut(s) 332, 567, 648, 728
Asp700I GAANNNNTTC 1 cut(s) 184
AspLEI GCGC 1 cut(s) 401
AspS9I GGNCC 3 cut(s) 10, 576, 803
AsuC2I CCSGG 2 cut(s) 193, 612
AsuHPI GGTGA 2 cut(s) 180, 492
AvaI CYCGRG 1 cut(s) 760
AvaII GGWCC 1 cut(s) 803
AxyI CCTNAGG 1 cut(s) 448
BbsI GAAGAC 1 cut(s) 309
BbvI GCAGC 1 cut(s) 439
BccI CCATC 5 cut(s) 374, 434, 471, 537, 698
BclI TGATCA 3 cut(s) 158, 710, 737
BcnI CCSGG 2 cut(s) 193, 612
BcoDI GTCTC 2 cut(s) 211, 752
BfmI CTRYAG 2 cut(s) 61, 634
BisI GCNGC 1 cut(s) 428
BlsI GCNGC 1 cut(s) 429
BmcAI AGTACT 1 cut(s) 135
Bme1390I CCNGG 2 cut(s) 193, 612
Bme18I GGWCC 1 cut(s) 803
BmeT110I CYCGRG 1 cut(s) 760
BmgT120I GGNCC 3 cut(s) 10, 576, 803
BmiI GGNNCC 3 cut(s) 11, 445, 675
BmrFI CCNGG 2 cut(s) 193, 612
BmrI ACTGGG 1 cut(s) 16
BmsI GCATC 3 cut(s) 125, 335, 357
BmuI ACTGGG 1 cut(s) 16
BpiI GAAGAC 1 cut(s) 309
BpuMI CCSGG 2 cut(s) 193, 612
BsaBI GATNNNNATC 2 cut(s) 481, 487
BsaI GGTCTC 1 cut(s) 211
BsaJI CCNNGG 3 cut(s) 191, 558, 610
BsaXI ACNNNNNCTCC 2 cut(s) 506, 536
Bsc4I CCNNNNNNNGG 2 cut(s) 376, 685
Bse1I ACTGG 2 cut(s) 11, 441
Bse21I CCTNAGG 1 cut(s) 448
Bse3DI GCAATG 1 cut(s) 28
Bse8I GATNNNNATC 2 cut(s) 481, 487
BseDI CCNNGG 3 cut(s) 191, 558, 610
BseGI GGATG 4 cut(s) 116, 385, 445, 713
BseJI GATNNNNATC 2 cut(s) 481, 487
BseLI CCNNNNNNNGG 2 cut(s) 376, 685
BseMI GCAATG 1 cut(s) 28
BseMII CTCAG 2 cut(s) 439, 668
BseNI ACTGG 2 cut(s) 11, 441
BseXI GCAGC 1 cut(s) 439
BsgI GTGCAG 2 cut(s) 150, 585
BshFI GGCC 3 cut(s) 12, 578, 689
BsiHKCI CYCGRG 1 cut(s) 760
BsiSI CCGG 2 cut(s) 193, 612
BslI CCNNNNNNNGG 2 cut(s) 376, 685
BsmAI GTCTC 2 cut(s) 211, 752
BsmI GAATGC 2 cut(s) 401, 835
BsnI GGCC 3 cut(s) 12, 578, 689
Bso31I GGTCTC 1 cut(s) 211
BsoBI CYCGRG 1 cut(s) 760
Bsp143I GATC 8 cut(s) 35, 50, 158, 195, 482, 710, 737, 824
BspACI CCGC 4 cut(s) 251, 263, 555, 679
BspANI GGCC 3 cut(s) 12, 578, 689
BspCNI CTCAG 2 cut(s) 440, 667
BspLI GGNNCC 3 cut(s) 11, 445, 675
BspMAI CTGCAG 2 cut(s) 65, 638
BspPI GGATC 3 cut(s) 45, 203, 477
BspTNI GGTCTC 1 cut(s) 211
BsrDI GCAATG 1 cut(s) 28
BsrI ACTGG 2 cut(s) 11, 441
BssECI CCNNGG 3 cut(s) 191, 558, 610
BssMI GATC 8 cut(s) 35, 50, 158, 195, 482, 710, 737, 824
BssT1I CCWWGG 1 cut(s) 558
BstDEI CTNAG 3 cut(s) 448, 654, 697
BstF5I GGATG 4 cut(s) 116, 385, 445, 713
BstHHI GCGC 1 cut(s) 401
BstKTI GATC 8 cut(s) 38, 53, 161, 198, 485, 713, 740, 827
BstMAI GTCTC 2 cut(s) 211, 752
BstMBI GATC 8 cut(s) 35, 50, 158, 195, 482, 710, 737, 824
BstMWI GCNNNNNNNGC 2 cut(s) 18, 83
BstSCI CCNGG 2 cut(s) 191, 610
BstSFI CTRYAG 2 cut(s) 61, 634
BstV1I GCAGC 1 cut(s) 439
BstV2I GAAGAC 1 cut(s) 309
Bsu36I CCTNAGG 1 cut(s) 448
BsuRI GGCC 3 cut(s) 12, 578, 689
BtsCI GGATG 4 cut(s) 116, 385, 445, 713
CfoI GCGC 1 cut(s) 401
Cfr13I GGNCC 3 cut(s) 10, 576, 803
Csp6I GTAC 4 cut(s) 106, 134, 526, 723
CviAII CATG 1 cut(s) 294
CviQI GTAC 4 cut(s) 106, 134, 526, 723
DdeI CTNAG 3 cut(s) 448, 654, 697
DpnI GATC 8 cut(s) 37, 52, 160, 197, 484, 712, 739, 826
DpnII GATC 8 cut(s) 35, 50, 158, 195, 482, 710, 737, 824
Eco130I CCWWGG 1 cut(s) 558
Eco31I GGTCTC 1 cut(s) 211
Eco47I GGWCC 1 cut(s) 803
Eco81I CCTNAGG 1 cut(s) 448
Eco88I CYCGRG 1 cut(s) 760
EcoO109I RGGNCCY 1 cut(s) 10
EcoRI GAATTC 1 cut(s) 648
EcoT14I CCWWGG 1 cut(s) 558
EcoT22I ATGCAT 1 cut(s) 350
ErhI CCWWGG 1 cut(s) 558
FaeI CATG 1 cut(s) 297
FatI CATG 1 cut(s) 293
FauI CCCGC 2 cut(s) 270, 686
FbaI TGATCA 3 cut(s) 158, 710, 737
Fnu4HI GCNGC 1 cut(s) 428
FokI GGATG 4 cut(s) 103, 392, 452, 700
Fsp4HI GCNGC 1 cut(s) 428
FspAI RTGCGCAY 1 cut(s) 400
FspI TGCGCA 1 cut(s) 400
GlaI GCGC 1 cut(s) 400
GluI GCNGC 1 cut(s) 428
HaeIII GGCC 3 cut(s) 12, 578, 689
HapII CCGG 2 cut(s) 193, 612
HhaI GCGC 1 cut(s) 401
Hin1II CATG 1 cut(s) 297
Hin6I GCGC 1 cut(s) 399
HinP1I GCGC 1 cut(s) 399
HinfI GANTC 1 cut(s) 240
HpaII CCGG 2 cut(s) 193, 612
HphI GGTGA 2 cut(s) 180, 492
Hpy166II GTNNAC 3 cut(s) 108, 188, 843
Hpy188I TCNGA 1 cut(s) 216
Hpy188III TCNNGA 2 cut(s) 45, 447
Hpy8I GTNNAC 3 cut(s) 108, 188, 843
Hpy99I CGWCG 1 cut(s) 803
HpyAV CCTTC 4 cut(s) 20, 416, 567, 633
HpyCH4V TGCA 8 cut(s) 21, 63, 131, 293, 330, 348, 602, 636
HpyF10VI GCNNNNNNNGC 2 cut(s) 18, 83
HpyF3I CTNAG 3 cut(s) 448, 654, 697
Hsp92II CATG 1 cut(s) 297
HspAI GCGC 1 cut(s) 399
Ksp22I TGATCA 3 cut(s) 158, 710, 737
Kzo9I GATC 8 cut(s) 35, 50, 158, 195, 482, 710, 737, 824
LmnI GCTCC 4 cut(s) 83, 228, 449, 514
Lsp1109I GCAGC 1 cut(s) 439
LweI GCATC 3 cut(s) 125, 335, 357
MalI GATC 8 cut(s) 37, 52, 160, 197, 484, 712, 739, 826
MboI GATC 8 cut(s) 35, 50, 158, 195, 482, 710, 737, 824
MboII GAAGA 1 cut(s) 314
MfeI CAATTG 1 cut(s) 78
MnlI CCTC 5 cut(s) 111, 282, 443, 663, 679
Mph1103I ATGCAT 1 cut(s) 350
MroXI GAANNNNTTC 1 cut(s) 184
MseI TTAA 3 cut(s) 94, 322, 811
MslI CAYNNNNRTG 2 cut(s) 394, 537
MspI CCGG 2 cut(s) 193, 612
MspR9I CCNGG 2 cut(s) 193, 612
MunI CAATTG 1 cut(s) 78
Mva1269I GAATGC 2 cut(s) 401, 835
MwoI GCNNNNNNNGC 2 cut(s) 18, 83
NciI CCSGG 2 cut(s) 193, 612
NdeII GATC 8 cut(s) 35, 50, 158, 195, 482, 710, 737, 824
NlaIII CATG 1 cut(s) 297
NlaIV GGNNCC 3 cut(s) 11, 445, 675
NsbI TGCGCA 1 cut(s) 400
NsiI ATGCAT 1 cut(s) 350
PctI GAATGC 2 cut(s) 401, 835
PdmI GAANNNNTTC 1 cut(s) 184
PfeI GAWTC 1 cut(s) 240
PkrI GCNGC 1 cut(s) 429
PspN4I GGNNCC 3 cut(s) 11, 445, 675
PspPI GGNCC 3 cut(s) 10, 576, 803
PstI CTGCAG 2 cut(s) 65, 638
RsaI GTAC 4 cut(s) 107, 135, 527, 724
RsaNI GTAC 4 cut(s) 106, 134, 526, 723
RseI CAYNNNNRTG 2 cut(s) 394, 537
SaqAI TTAA 3 cut(s) 94, 322, 811
SatI GCNGC 1 cut(s) 428
Sau3AI GATC 8 cut(s) 35, 50, 158, 195, 482, 710, 737, 824
Sau96I GGNCC 3 cut(s) 10, 576, 803
ScaI AGTACT 1 cut(s) 135
ScrFI CCNGG 2 cut(s) 193, 612
SetI ASST 8 cut(s) 233, 329, 454, 519, 587, 598, 698, 706
SfaNI GCATC 3 cut(s) 125, 335, 357
SfcI CTRYAG 2 cut(s) 61, 634
SinI GGWCC 1 cut(s) 803
SmiMI CAYNNNNRTG 2 cut(s) 394, 537
SsiI CCGC 4 cut(s) 251, 263, 555, 679
SspI AATATT 1 cut(s) 125
StyD4I CCNGG 2 cut(s) 191, 610
StyI CCWWGG 1 cut(s) 558
TaqI TCGA 1 cut(s) 827
TatI WGTACW 1 cut(s) 133
TfiI GAWTC 1 cut(s) 240
Tru1I TTAA 3 cut(s) 94, 322, 811
Tru9I TTAA 3 cut(s) 94, 322, 811
TseI GCWGC 1 cut(s) 427
TspDTI ATGAA 2 cut(s) 39, 394
TspGWI ACGGA 3 cut(s) 93, 233, 816
VpaK11BI GGWCC 1 cut(s) 803
XapI RAATTY 4 cut(s) 332, 567, 648, 728
XcmI CCANNNNNNNNNTGG 1 cut(s) 273
XmnI GAANNNNTTC 1 cut(s) 184
ZrmI AGTACT 1 cut(s) 135
Zsp2I ATGCAT 1 cut(s) 350
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.