Rmu_sc0000965.1_g000010

DEAD-box ATP-dependent RNA helicase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000965.1
Physical Location & Seq
Forward (+)
47375 .. 53801
6427 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000965.1_g000010.1.cds

Sequence Viewer

Length: 1212 bp
atgattgagagatcacgagtttccctcaaaatgatcaagtatttagcagtagatgataggatgttggacatgggttttgaacctcaaatatcaaagattgttcgacaaatggacatgccttccccaggtgcaagacaaactctgcttttcagtgctacattccctatgagatacaggtggaggcttgcttcagaactcctccaaaaatacatattttcgactattggaatagttgggactggggacaagataaggaatttatgtggtcttcttcttaagaaccagagggaaattgaaactcatggaaagggggacaaagggataacaaatttgaaatcagctgatgtagaggtagctcctgagaatgcttttggtgagactattattgagagtcaagaggagttccttcaaaaaatctctactctcaaggattgcatccgggaagagatggctaaagggactacaaatattgcattcatgactcggacggggattaccgctgctgtagattccagaacatggcatcgccaatttatagagagatcaaatttacattgcacagccatgggtcttgttcgtaggtggaatgatctgttcaactatgtgagccagaatctagcctatggaaattcagtccattcatatagcaggaaatcaaccttatgtggaactgtggaagggatgagtccaccagaagaagtactagaagaaccttcattttggacatgtggagtgatattgggatctggctcttcacatgcttatccagttatgatacgaggctatgacgatgcagctgacacagctttagaaggtttgtttgcggcatctttggaagataagtacacaggaggtcttacgcttgcagagtattttcttgatccagccttggaaccaaaggcccatctctttagaatttcttacagaaaactggtatatgtcgtttatcttgattttcactggaaatatgcaatacctatttattactatatacttcttaacaggccatatggaggagagattgattcagcaaattgtgtagcagttaagagagatttctatgcttttcgtgtggtattcgagactgaagaagatgctacaatagcaaatgaaggtatttatgacccatcagttgcctgtggaacttcaacagatgcctcgacctatggaaaacagttggtttcgttttggtattctaaatgtgctacctag

Protein Analysis

403

Amino Acids

45.53

Weight (kDa)

5.9

Isoelectric Point (pI)

44.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 519
AciI CCGC 2 cut(s) 498, 824
AclWI GGATC 2 cut(s) 751, 875
AcsI RAATTY 5 cut(s) 256, 328, 547, 628, 915
AcuI CTGAAG 2 cut(s) 174, 1107
AfaI GTAC 2 cut(s) 702, 845
AfiI CCNNNNNNNGG 3 cut(s) 125, 519, 1013
AflII CTTAAG 1 cut(s) 275
AflIII ACRYGT 1 cut(s) 725
AgsI TTSAA 6 cut(s) 80, 296, 334, 410, 598, 1149
AjnI CCWGG 1 cut(s) 124
AluBI AGCT 4 cut(s) 341, 356, 797, 806
AluI AGCT 4 cut(s) 341, 356, 797, 806
Alw26I GTCTC 2 cut(s) 371, 1076
AlwI GGATC 2 cut(s) 751, 875
AoxI GGCC 2 cut(s) 900, 1004
ApeKI GCWGC 2 cut(s) 500, 794
ApoI RAATTY 5 cut(s) 256, 328, 547, 628, 915
ArsI GACNNNNNNTTYG 2 cut(s) 59, 91
AspS9I GGNCC 1 cut(s) 901
AsuC2I CCSGG 1 cut(s) 440
AsuHPI GGTGA 1 cut(s) 386
BauI CACGAG 1 cut(s) 15
BbsI GAAGAC 1 cut(s) 260
BbvI GCAGC 2 cut(s) 487, 806
BccI CCATC 3 cut(s) 442, 912, 1135
BciT130I CCWGG 1 cut(s) 126
BclI TGATCA 1 cut(s) 33
BcnI CCSGG 1 cut(s) 440
BcoDI GTCTC 2 cut(s) 371, 1076
BfaI CTAG 3 cut(s) 617, 704, 1210
BfmI CTRYAG 1 cut(s) 504
BfrI CTTAAG 1 cut(s) 275
BisI GCNGC 3 cut(s) 501, 795, 825
BlsI GCNGC 3 cut(s) 502, 796, 826
BmcAI AGTACT 1 cut(s) 702
Bme1390I CCNGG 2 cut(s) 126, 440
BmgT120I GGNCC 1 cut(s) 901
BmiI GGNNCC 1 cut(s) 894
BmrFI CCNGG 2 cut(s) 126, 440
BmrI ACTGGG 1 cut(s) 249
BmsI GCATC 6 cut(s) 444, 532, 781, 836, 1084, 1144
BmuI ACTGGG 1 cut(s) 249
BpiI GAAGAC 1 cut(s) 260
BplI GAGNNNNNCTC 2 cut(s) 9, 41
BpuEI CTTGAG 1 cut(s) 410
BpuMI CCSGG 1 cut(s) 440
BsaJI CCNNGG 3 cut(s) 124, 564, 888
Bsc4I CCNNNNNNNGG 3 cut(s) 125, 519, 1013
Bse1I ACTGG 4 cut(s) 244, 767, 936, 965
Bse3DI GCAATG 1 cut(s) 553
BseBI CCWGG 1 cut(s) 126
BseDI CCNNGG 3 cut(s) 124, 564, 888
BseGI GGATG 3 cut(s) 66, 435, 687
BseLI CCNNNNNNNGG 3 cut(s) 125, 519, 1013
BseMI GCAATG 1 cut(s) 553
BseMII CTCAG 1 cut(s) 351
BseNI ACTGG 4 cut(s) 244, 767, 936, 965
BseRI GAGGAG 3 cut(s) 188, 413, 1029
BseXI GCAGC 2 cut(s) 487, 806
BshFI GGCC 2 cut(s) 902, 1006
BsiSI CCGG 1 cut(s) 439
BslFI GGGAC 4 cut(s) 250, 257, 326, 472
BslI CCNNNNNNNGG 3 cut(s) 125, 519, 1013
BsmAI GTCTC 2 cut(s) 371, 1076
BsmFI GGGAC 4 cut(s) 250, 257, 326, 472
BsmI GAATGC 2 cut(s) 370, 473
BsnI GGCC 2 cut(s) 902, 1006
Bsp143I GATC 6 cut(s) 11, 33, 542, 589, 743, 880
Bsp19I CCATGG 1 cut(s) 564
BspACI CCGC 2 cut(s) 498, 824
BspANI GGCC 2 cut(s) 902, 1006
BspCNI CTCAG 1 cut(s) 352
BspHI TCATGA 1 cut(s) 477
BspLI GGNNCC 1 cut(s) 894
BspPI GGATC 2 cut(s) 751, 875
BspQI GCTCTTC 1 cut(s) 757
BspTI CTTAAG 1 cut(s) 275
BsrDI GCAATG 1 cut(s) 553
BsrI ACTGG 4 cut(s) 244, 767, 936, 965
BssECI CCNNGG 3 cut(s) 124, 564, 888
BssMI GATC 6 cut(s) 11, 33, 542, 589, 743, 880
BssSI CACGAG 1 cut(s) 15
BssT1I CCWWGG 2 cut(s) 564, 888
Bst2BI CACGAG 1 cut(s) 15
Bst2UI CCWGG 1 cut(s) 126
Bst4CI ACNGT 2 cut(s) 673, 1176
Bst6I CTCTTC 2 cut(s) 438, 757
BstAFI CTTAAG 1 cut(s) 275
BstC8I GCNNGC 2 cut(s) 186, 864
BstDEI CTNAG 1 cut(s) 360
BstDSI CCRYGG 1 cut(s) 564
BstENI CCTNNNNNAGG 1 cut(s) 123
BstF5I GGATG 3 cut(s) 66, 435, 687
BstKTI GATC 6 cut(s) 14, 36, 545, 592, 746, 883
BstMAI GTCTC 2 cut(s) 371, 1076
BstMBI GATC 6 cut(s) 11, 33, 542, 589, 743, 880
BstMWI GCNNNNNNNGC 2 cut(s) 803, 1103
BstNI CCWGG 1 cut(s) 126
BstNSI RCATGY 3 cut(s) 118, 729, 761
BstSCI CCNGG 2 cut(s) 124, 438
BstSFI CTRYAG 1 cut(s) 504
BstV1I GCAGC 2 cut(s) 487, 806
BstV2I GAAGAC 1 cut(s) 260
BstX2I RGATCY 1 cut(s) 743
BstYI RGATCY 1 cut(s) 743
BsuRI GGCC 2 cut(s) 902, 1006
BtgI CCRYGG 1 cut(s) 564
BtgZI GCGATG 1 cut(s) 509
BtsCI GGATG 3 cut(s) 66, 435, 687
BtsIMutI CAGTG 2 cut(s) 157, 958
Cac8I GCNNGC 2 cut(s) 186, 864
CciI TCATGA 1 cut(s) 477
Cfr13I GGNCC 1 cut(s) 901
Csp6I GTAC 2 cut(s) 701, 844
CviAII CATG 8 cut(s) 70, 115, 302, 478, 519, 565, 726, 758
CviQI GTAC 2 cut(s) 701, 844
DdeI CTNAG 1 cut(s) 360
DpnI GATC 6 cut(s) 13, 35, 544, 591, 745, 882
DpnII GATC 6 cut(s) 11, 33, 542, 589, 743, 880
Eam1104I CTCTTC 2 cut(s) 438, 757
EarI CTCTTC 2 cut(s) 438, 757
Eco130I CCWWGG 2 cut(s) 564, 888
Eco57I CTGAAG 2 cut(s) 174, 1107
EcoNI CCTNNNNNAGG 1 cut(s) 123
EcoRII CCWGG 1 cut(s) 124
EcoT14I CCWWGG 2 cut(s) 564, 888
ErhI CCWWGG 2 cut(s) 564, 888
FaeI CATG 8 cut(s) 73, 118, 305, 481, 522, 568, 729, 761
FaqI GGGAC 4 cut(s) 250, 257, 326, 472
FatI CATG 8 cut(s) 69, 114, 301, 477, 518, 564, 725, 757
FauNDI CATATG 1 cut(s) 1009
FbaI TGATCA 1 cut(s) 33
Fnu4HI GCNGC 3 cut(s) 501, 795, 825
FokI GGATG 3 cut(s) 73, 422, 694
Fsp4HI GCNGC 3 cut(s) 501, 795, 825
FspBI CTAG 3 cut(s) 617, 704, 1210
GluI GCNGC 3 cut(s) 501, 795, 825
HaeIII GGCC 2 cut(s) 902, 1006
HapII CCGG 1 cut(s) 439
Hin1II CATG 8 cut(s) 73, 118, 305, 481, 522, 568, 729, 761
HinfI GANTC 6 cut(s) 391, 481, 509, 613, 685, 1025
HpaII CCGG 1 cut(s) 439
HphI GGTGA 1 cut(s) 386
Hpy166II GTNNAC 2 cut(s) 689, 846
Hpy188I TCNGA 2 cut(s) 193, 486
Hpy188III TCNNGA 8 cut(s) 15, 359, 395, 478, 513, 878, 950, 1081
Hpy8I GTNNAC 2 cut(s) 689, 846
HpyAV CCTTC 6 cut(s) 129, 416, 671, 723, 806, 1106
HpyCH4III ACNGT 2 cut(s) 673, 1176
HpyCH4V TGCA 7 cut(s) 131, 435, 473, 558, 794, 866, 971
HpyF10VI GCNNNNNNNGC 2 cut(s) 803, 1103
HpyF3I CTNAG 1 cut(s) 360
Hsp92II CATG 8 cut(s) 73, 118, 305, 481, 522, 568, 729, 761
Ksp22I TGATCA 1 cut(s) 33
Kzo9I GATC 6 cut(s) 11, 33, 542, 589, 743, 880
LguI GCTCTTC 1 cut(s) 757
LmnI GCTCC 1 cut(s) 361
Lsp1109I GCAGC 2 cut(s) 487, 806
LweI GCATC 6 cut(s) 444, 532, 781, 836, 1084, 1144
MaeI CTAG 3 cut(s) 617, 704, 1210
MalI GATC 6 cut(s) 13, 35, 544, 591, 745, 882
MboI GATC 6 cut(s) 11, 33, 542, 589, 743, 880
MboII GAAGA 9 cut(s) 260, 263, 455, 707, 719, 744, 848, 1100, 1103
MflI RGATCY 1 cut(s) 743
MluCI AATT 8 cut(s) 256, 291, 328, 530, 547, 628, 915, 1033
MlyI GAGTC 3 cut(s) 400, 475, 694
MmeI TCCRAC 1 cut(s) 45
MseI TTAA 3 cut(s) 276, 999, 1047
MslI CAYNNNNRTG 1 cut(s) 563
MspA1I CMGCKG 3 cut(s) 341, 500, 797
MspCI CTTAAG 1 cut(s) 275
MspI CCGG 1 cut(s) 439
MspR9I CCNGG 2 cut(s) 126, 440
Mva1269I GAATGC 2 cut(s) 370, 473
MvaI CCWGG 1 cut(s) 126
MwoI GCNNNNNNNGC 2 cut(s) 803, 1103
NciI CCSGG 1 cut(s) 440
NcoI CCATGG 1 cut(s) 564
NdeI CATATG 1 cut(s) 1009
NdeII GATC 6 cut(s) 11, 33, 542, 589, 743, 880
NlaIII CATG 8 cut(s) 73, 118, 305, 481, 522, 568, 729, 761
NlaIV GGNNCC 1 cut(s) 894
NspI RCATGY 3 cut(s) 118, 729, 761
PagI TCATGA 1 cut(s) 477
PciI ACATGT 1 cut(s) 725
PciSI GCTCTTC 1 cut(s) 757
PctI GAATGC 2 cut(s) 370, 473
PfeI GAWTC 3 cut(s) 509, 613, 1025
PflMI CCANNNNNTGG 1 cut(s) 519
PfoI TCCNGGA 1 cut(s) 438
PkrI GCNGC 3 cut(s) 502, 796, 826
PleI GAGTC 3 cut(s) 399, 475, 693
PpsI GAGTC 3 cut(s) 399, 475, 693
PscI ACATGT 1 cut(s) 725
Psp6I CCWGG 1 cut(s) 124
PspGI CCWGG 1 cut(s) 124
PspN4I GGNNCC 1 cut(s) 894
PspPI GGNCC 1 cut(s) 901
PsuI RGATCY 1 cut(s) 743
PvuII CAGCTG 2 cut(s) 341, 797
RsaI GTAC 2 cut(s) 702, 845
RsaNI GTAC 2 cut(s) 701, 844
RseI CAYNNNNRTG 1 cut(s) 563
SapI GCTCTTC 1 cut(s) 757
SaqAI TTAA 3 cut(s) 276, 999, 1047
SatI GCNGC 3 cut(s) 501, 795, 825
Sau3AI GATC 6 cut(s) 11, 33, 542, 589, 743, 880
Sau96I GGNCC 1 cut(s) 901
ScaI AGTACT 1 cut(s) 702
SchI GAGTC 3 cut(s) 400, 475, 694
ScrFI CCNGG 2 cut(s) 126, 440
SfaNI GCATC 6 cut(s) 444, 532, 781, 836, 1084, 1144
SfcI CTRYAG 1 cut(s) 504
SmiMI CAYNNNNRTG 1 cut(s) 563
SmlI CTYRAG 2 cut(s) 275, 425
SmoI CTYRAG 2 cut(s) 275, 425
Sse9I AATT 8 cut(s) 256, 291, 328, 530, 547, 628, 915, 1033
SsiI CCGC 2 cut(s) 498, 824
SspI AATATT 1 cut(s) 469
SspMI CTAG 3 cut(s) 617, 704, 1210
StyD4I CCNGG 2 cut(s) 124, 438
StyI CCWWGG 2 cut(s) 564, 888
TaaI ACNGT 2 cut(s) 673, 1176
TaqI TCGA 4 cut(s) 103, 218, 1080, 1160
TasI AATT 8 cut(s) 256, 291, 328, 530, 547, 628, 915, 1033
TatI WGTACW 2 cut(s) 700, 843
TauI GCSGC 1 cut(s) 827
TfiI GAWTC 3 cut(s) 509, 613, 1025
Tru1I TTAA 3 cut(s) 276, 999, 1047
Tru9I TTAA 3 cut(s) 276, 999, 1047
TscAI CASTG 2 cut(s) 157, 965
TseI GCWGC 2 cut(s) 500, 794
TspDTI ATGAA 4 cut(s) 466, 630, 705, 1125
TspRI CASTG 2 cut(s) 157, 965
Van91I CCANNNNNTGG 1 cut(s) 519
Vha464I CTTAAG 1 cut(s) 275
XagI CCTNNNNNAGG 1 cut(s) 123
XapI RAATTY 5 cut(s) 256, 328, 547, 628, 915
XceI RCATGY 3 cut(s) 118, 729, 761
XspI CTAG 3 cut(s) 617, 704, 1210
ZrmI AGTACT 1 cut(s) 702
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.