Rmu_sc0001207.1_g000101

elicitor-responsive protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001207.1
Physical Location & Seq
Reverse (-)
424481 .. 426572
2092 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001207.1_g000101.1.cds

Sequence Viewer

Length: 945 bp
atgcctcgaggaacacttgaagttgttcttgttgatgccagaggcctcgacaacaatgattttctcgctaaaatatccccctatgctgttttaactgtgaagacccaagaaaagaaaagcactgtgcttacagggaaaggatctaacccagaatggaatgaatcctttctgttcacaatctcggacgatgaagtcaaggaactccatctgacaataatggacaaagataacttcagtgccgatgattttgttggagaagcaaccattcctttactgccagcttttgtcaaaggaactgttaacccaactacgtacaacattgtcaataaggagaaggaatttcatggtggggttaaacttggactcacgttcactcctgagtctggttttgagcccgggagaagcgattttgaatctggagaacatggtgaggagggctctggtggatggaaacaatcatctcatggggaggacataccgggtggatggaaagaacaaccttctggggaggtgggactaggtggaaggaatgaaccaccttatggggaggagagaccaccttacggggagagaccaccttacggtgaggagagaccgccttacggtgaggagagaccgccttacaggcaggagggaccacctttcggagaggagaggccgccttacaggcaggcgaggccaccttatggggaggagaggccaccttttgggggggagaggccaccttatggggaagagagaccaccttatggggaggagaggccacctttcggggaggagagacatggtggaaggaatgaaccaccttatggggaagagagaccaccttacggggaggagaggccacctttcggggaggagagacatggtggaaggaatgaaccgccttatggggaggagagaccgggtggatggaaacactcctctttcgatgaggaaagatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

314

Amino Acids

35.17

Weight (kDa)

4.8

Isoelectric Point (pI)

57.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000507)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G63220 AT1G63220
fragaria_vesca FvH4_7g13480 FvH4_7g13490 FvH4_7g13490 FvH4_7g13491 FvH4_7g13500 FvH4_7g13500 FvH4_7g13500
malus_domestica MD01G1048800.v1.1 MD01G1049000.v1.1
prunus_persica Prupe.2G158500_v2.0.a1 Prupe.2G158500_v2.0.a1 Prupe.2G158500_v2.0.a1 Prupe.2G158700_v2.0.a1 Prupe.2G158800_v2.0.a1 Prupe.2G159000_v2.0.a1 Prupe.2G159000_v2.0.a1
pyrus_communis pycom01g07400 pycom01g07420 pycom07g12030
rosa_chinensis RchiOBHm_Chr1g0352961 RchiOBHm_Chr1g0352971 RchiOBHm_Chr1g0352981 RchiOBHm_Chr1g0353001 RchiOBHm_Chr1g0353011 RchiOBHm_Chr1g0353021 RchiOBHm_Chr1g0353061
rosa_laevigata RLG00000028293 RLG00000028297 RLG00000028298 RLG00000028299 RLG00000028300 RLG00000028301 RLG00000028302
rosa_multiflora Rmu_sc0001207.1_g000095 Rmu_sc0001207.1_g000101 Rmu_sc0001207.1_g000102 Rmu_sc0001207.1_g000103 Rmu_sc0003313.1_g000001 Rmu_sc0005122.1_g000001 Rmu_sc0005122.1_g000002 Rmu_sc0006830.1_g000001 Rmu_sc0006830.1_g000002 Rmu_sc0008840.1_g000005
rosa_roxburghii Rroxscaffold_4G00302170 Rroxscaffold_4G00302180 Rroxscaffold_4G00302190 Rroxscaffold_4G00302200 Rroxscaffold_4G00302220
rosa_rugosa Rorug01G0232400 Rorug01G0232500 Rorug01G0232700 Rorug01G0232700 Rorug01G0232800 Rorug01G0232900 Rorug01G0233000 Rorug01G0233100 Rorug01G0233200 Rorug01G0233300 Rorug01G0233400
rosa_samantha Rh1AG245700 Rh1AG245900 Rh1AG246000 Rh1AG246100 Rh1AG246200 Rh1AG246800 Rh1BG216000 Rh1BG216100 Rh1BG216200 Rh1BG216400 Rh1BG216500 Rh1BG216600 Rh1CG229500 Rh1CG229700 Rh1CG229800 Rh1CG230500 Rh1DG242100 Rh1DG242200 Rh1DG242300 Rh1DG242500 Rh1DG242600 Rh1DG242700
rosa_wichuraiana Rw0G014880 Rw0G014910 Rw0G018130 Rw1G021350

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 191
AbsI CCTCGAGG 1 cut(s) 6
AccB7I CCANNNNNTGG 6 cut(s) 542, 686, 707, 728, 749, 809
AciI CCGC 4 cut(s) 596, 617, 659, 884
AclWI GGATC 1 cut(s) 148
AcsI RAATTY 1 cut(s) 338
AcuI CTGAAG 1 cut(s) 217
AfaI GTAC 1 cut(s) 314
AgsI TTSAA 2 cut(s) 20, 413
AluBI AGCT 1 cut(s) 281
AluI AGCT 1 cut(s) 281
Alw26I GTCTC 9 cut(s) 547, 565, 586, 607, 733, 775, 814, 856, 895
AlwI GGATC 1 cut(s) 148
Ama87I CYCGRG 2 cut(s) 6, 395
AoxI GGCC 7 cut(s) 43, 656, 677, 698, 719, 761, 842
ApoI RAATTY 1 cut(s) 338
Asp700I GAANNNNTTC 2 cut(s) 24, 165
AspS9I GGNCC 1 cut(s) 635
AsuC2I CCSGG 4 cut(s) 396, 397, 480, 906
AsuHPI GGTGA 3 cut(s) 440, 596, 617
AvaI CYCGRG 2 cut(s) 6, 395
AvaII GGWCC 1 cut(s) 635
BanII GRGCYC 2 cut(s) 396, 440
BbsI GAAGAC 1 cut(s) 107
BccI CCATC 4 cut(s) 213, 441, 480, 906
BcnI CCSGG 4 cut(s) 396, 397, 480, 906
BcoDI GTCTC 9 cut(s) 547, 565, 586, 607, 733, 775, 814, 856, 895
BfaI CTAG 1 cut(s) 518
BglI GCCNNNNNGGC 2 cut(s) 625, 667
BisI GCNGC 1 cut(s) 659
BlsI GCNGC 1 cut(s) 660
Bme1390I CCNGG 4 cut(s) 396, 397, 480, 906
Bme18I GGWCC 1 cut(s) 635
BmeT110I CYCGRG 2 cut(s) 6, 395
BmgT120I GGNCC 1 cut(s) 635
BmiI GGNNCC 1 cut(s) 636
BmrFI CCNGG 4 cut(s) 396, 397, 480, 906
BmsI GCATC 1 cut(s) 25
BpiI GAAGAC 1 cut(s) 107
BplI GAGNNNNNCTC 2 cut(s) 422, 454
BpmI CTGGAG 1 cut(s) 438
BpuMI CCSGG 4 cut(s) 396, 397, 480, 906
BsaAI YACGTR 1 cut(s) 312
BsaI GGTCTC 7 cut(s) 547, 565, 586, 607, 733, 814, 895
BsaJI CCNNGG 1 cut(s) 395
BsaXI ACNNNNNCTCC 2 cut(s) 358, 388
BseDI CCNNGG 1 cut(s) 395
BseGI GGATG 3 cut(s) 452, 491, 917
BseMII CTCAG 1 cut(s) 369
BshFI GGCC 7 cut(s) 45, 658, 679, 700, 721, 763, 844
BsiHKCI CYCGRG 2 cut(s) 6, 395
BsiSI CCGG 3 cut(s) 396, 479, 905
BslFI GGGAC 2 cut(s) 528, 648
BsmAI GTCTC 9 cut(s) 547, 565, 586, 607, 733, 775, 814, 856, 895
BsmFI GGGAC 2 cut(s) 528, 648
BsnI GGCC 7 cut(s) 45, 658, 679, 700, 721, 763, 844
Bso31I GGTCTC 7 cut(s) 547, 565, 586, 607, 733, 814, 895
BsoBI CYCGRG 2 cut(s) 6, 395
Bsp1286I GDGCHC 2 cut(s) 396, 440
Bsp143I GATC 1 cut(s) 140
BspACI CCGC 4 cut(s) 596, 617, 659, 884
BspANI GGCC 7 cut(s) 45, 658, 679, 700, 721, 763, 844
BspCNI CTCAG 1 cut(s) 370
BspLI GGNNCC 1 cut(s) 636
BspPI GGATC 1 cut(s) 148
BspTNI GGTCTC 7 cut(s) 547, 565, 586, 607, 733, 814, 895
BssECI CCNNGG 1 cut(s) 395
BssMI GATC 1 cut(s) 140
Bst4CI ACNGT 5 cut(s) 97, 124, 298, 584, 605
Bst6I CTCTTC 2 cut(s) 729, 810
BstBAI YACGTR 1 cut(s) 312
BstC8I GCNNGC 2 cut(s) 279, 672
BstDEI CTNAG 1 cut(s) 378
BstF5I GGATG 3 cut(s) 452, 491, 917
BstKTI GATC 1 cut(s) 143
BstMAI GTCTC 9 cut(s) 547, 565, 586, 607, 733, 775, 814, 856, 895
BstMBI GATC 1 cut(s) 140
BstMWI GCNNNNNNNGC 3 cut(s) 625, 667, 676
BstSCI CCNGG 4 cut(s) 394, 395, 478, 904
BstSNI TACGTA 1 cut(s) 312
BstV2I GAAGAC 1 cut(s) 107
BstX2I RGATCY 1 cut(s) 140
BstYI RGATCY 1 cut(s) 140
BsuRI GGCC 7 cut(s) 45, 658, 679, 700, 721, 763, 844
BtsCI GGATG 3 cut(s) 452, 491, 917
BtsIMutI CAGTG 2 cut(s) 120, 241
Cac8I GCNNGC 2 cut(s) 279, 672
Cfr13I GGNCC 1 cut(s) 635
Cfr9I CCCGGG 1 cut(s) 395
Csp6I GTAC 1 cut(s) 313
CviAII CATG 5 cut(s) 344, 425, 464, 785, 866
CviQI GTAC 1 cut(s) 313
DdeI CTNAG 1 cut(s) 378
DpnI GATC 1 cut(s) 142
DpnII GATC 1 cut(s) 140
DrdI GACNNNNNNGTC 1 cut(s) 191
DseDI GACNNNNNNGTC 1 cut(s) 191
Eam1104I CTCTTC 2 cut(s) 729, 810
EarI CTCTTC 2 cut(s) 729, 810
Eco105I TACGTA 1 cut(s) 312
Eco147I AGGCCT 1 cut(s) 45
Eco24I GRGCYC 2 cut(s) 396, 440
Eco31I GGTCTC 7 cut(s) 547, 565, 586, 607, 733, 814, 895
Eco47I GGWCC 1 cut(s) 635
Eco57I CTGAAG 1 cut(s) 217
Eco88I CYCGRG 2 cut(s) 6, 395
EcoT38I GRGCYC 2 cut(s) 396, 440
FaeI CATG 5 cut(s) 347, 428, 467, 788, 869
FalI AAGNNNNNCTT 2 cut(s) 12, 44
FaqI GGGAC 2 cut(s) 528, 648
FatI CATG 5 cut(s) 343, 424, 463, 784, 865
Fnu4HI GCNGC 1 cut(s) 659
FokI GGATG 3 cut(s) 459, 498, 924
FriOI GRGCYC 2 cut(s) 396, 440
Fsp4HI GCNGC 1 cut(s) 659
FspBI CTAG 1 cut(s) 518
GluI GCNGC 1 cut(s) 659
GsuI CTGGAG 1 cut(s) 438
HaeIII GGCC 7 cut(s) 45, 658, 679, 700, 721, 763, 844
HapII CCGG 3 cut(s) 396, 479, 905
Hin1II CATG 5 cut(s) 347, 428, 467, 788, 869
HincII GTYRAC 1 cut(s) 301
HindII GTYRAC 1 cut(s) 301
HinfI GANTC 4 cut(s) 161, 363, 380, 413
HpaI GTTAAC 1 cut(s) 301
HpaII CCGG 3 cut(s) 396, 479, 905
HphI GGTGA 3 cut(s) 440, 596, 617
Hpy166II GTNNAC 3 cut(s) 174, 301, 372
Hpy188I TCNGA 3 cut(s) 184, 210, 647
Hpy188III TCNNGA 2 cut(s) 377, 417
Hpy8I GTNNAC 3 cut(s) 174, 301, 372
HpyAV CCTTC 5 cut(s) 328, 510, 519, 786, 867
HpyCH4III ACNGT 5 cut(s) 97, 124, 298, 584, 605
HpyCH4IV ACGT 2 cut(s) 311, 368
HpyF10VI GCNNNNNNNGC 3 cut(s) 625, 667, 676
HpyF3I CTNAG 1 cut(s) 378
HpySE526I ACGT 2 cut(s) 311, 368
Hsp92II CATG 5 cut(s) 347, 428, 467, 788, 869
KspAI GTTAAC 1 cut(s) 301
Kzo9I GATC 1 cut(s) 140
LweI GCATC 1 cut(s) 25
MaeI CTAG 1 cut(s) 518
MaeII ACGT 2 cut(s) 311, 368
MalI GATC 1 cut(s) 142
MboI GATC 1 cut(s) 140
MboII GAAGA 3 cut(s) 112, 746, 827
MflI RGATCY 1 cut(s) 140
MhlI GDGCHC 2 cut(s) 396, 440
MluCI AATT 1 cut(s) 338
MlyI GAGTC 2 cut(s) 357, 389
MmeI TCCRAC 1 cut(s) 232
MroXI GAANNNNTTC 2 cut(s) 24, 165
MseI TTAA 3 cut(s) 92, 300, 354
MspI CCGG 3 cut(s) 396, 479, 905
MspR9I CCNGG 4 cut(s) 396, 397, 480, 906
MwoI GCNNNNNNNGC 3 cut(s) 625, 667, 676
NciI CCSGG 4 cut(s) 396, 397, 480, 906
NdeII GATC 1 cut(s) 140
NlaIII CATG 5 cut(s) 347, 428, 467, 788, 869
NlaIV GGNNCC 1 cut(s) 636
PaeR7I CTCGAG 1 cut(s) 6
PceI AGGCCT 1 cut(s) 45
PdmI GAANNNNTTC 2 cut(s) 24, 165
PfeI GAWTC 2 cut(s) 161, 413
PflMI CCANNNNNTGG 6 cut(s) 542, 686, 707, 728, 749, 809
PkrI GCNGC 1 cut(s) 660
PleI GAGTC 2 cut(s) 357, 388
PpsI GAGTC 2 cut(s) 357, 388
Ppu21I YACGTR 1 cut(s) 312
PspN4I GGNNCC 1 cut(s) 636
PspPI GGNCC 1 cut(s) 635
PspXI VCTCGAGB 1 cut(s) 6
PsuI RGATCY 1 cut(s) 140
RsaI GTAC 1 cut(s) 314
RsaNI GTAC 1 cut(s) 313
SaqAI TTAA 3 cut(s) 92, 300, 354
SatI GCNGC 1 cut(s) 659
Sau3AI GATC 1 cut(s) 140
Sau96I GGNCC 1 cut(s) 635
SchI GAGTC 2 cut(s) 357, 389
ScrFI CCNGG 4 cut(s) 396, 397, 480, 906
SduI GDGCHC 2 cut(s) 396, 440
SfaNI GCATC 1 cut(s) 25
Sfr274I CTCGAG 1 cut(s) 6
SinI GGWCC 1 cut(s) 635
SlaI CTCGAG 1 cut(s) 6
SmaI CCCGGG 1 cut(s) 397
SmlI CTYRAG 1 cut(s) 6
SmoI CTYRAG 1 cut(s) 6
SnaBI TACGTA 1 cut(s) 312
Sse9I AATT 1 cut(s) 338
SseBI AGGCCT 1 cut(s) 45
SsiI CCGC 4 cut(s) 596, 617, 659, 884
SspMI CTAG 1 cut(s) 518
StuI AGGCCT 1 cut(s) 45
StyD4I CCNGG 4 cut(s) 394, 395, 478, 904
TaaI ACNGT 5 cut(s) 97, 124, 298, 584, 605
TaiI ACGT 2 cut(s) 314, 371
TaqI TCGA 3 cut(s) 7, 48, 930
TasI AATT 1 cut(s) 338
TauI GCSGC 1 cut(s) 661
TfiI GAWTC 2 cut(s) 161, 413
Tru1I TTAA 3 cut(s) 92, 300, 354
Tru9I TTAA 3 cut(s) 92, 300, 354
TscAI CASTG 2 cut(s) 127, 241
TspDTI ATGAA 6 cut(s) 174, 204, 332, 546, 813, 894
TspMI CCCGGG 1 cut(s) 395
TspRI CASTG 2 cut(s) 127, 241
Van91I CCANNNNNTGG 6 cut(s) 542, 686, 707, 728, 749, 809
VpaK11BI GGWCC 1 cut(s) 635
XapI RAATTY 1 cut(s) 338
XhoI CTCGAG 1 cut(s) 6
XmaI CCCGGG 1 cut(s) 395
XmnI GAANNNNTTC 2 cut(s) 24, 165
XspI CTAG 1 cut(s) 518
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.