Rmu_sc0002393.1_g000026

Encoded by

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002393.1
Physical Location & Seq
Reverse (-)
122963 .. 123355
393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002393.1_g000026.1.cds

Sequence Viewer

Length: 393 bp
atgcgctttatttctacacccattaggaccttaacagaggccaagaacttctacatgaggaacctcgaagattgtgcaggtaaggtgggttatggtggtgcaggtgtcagtggttacaccgcttcgaacgttcacttgcctaggagctttagtgttaactcttcaaattcaaatggtgatgaggatttgaagcagctacgcagattaaccgtttcgacaaaaaagaacaacgatgtgaagaaagagggtagcagagcagctggaggttccgacacgcagagaaggccgattgttagagaacgtcccattgtcaaacaacgcacaatgaatagtgggatgggcatgaggagttatagtgttggcttgaaaatgggaaggattgatgaagaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

130

Amino Acids

14.38

Weight (kDa)

10.18

Isoelectric Point (pI)

40.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 92
Acc36I ACCTGC 2 cut(s) 68, 92
AciI CCGC 1 cut(s) 120
AclI AACGTT 1 cut(s) 129
AcsI RAATTY 1 cut(s) 166
AgsI TTSAA 4 cut(s) 165, 171, 190, 367
AluBI AGCT 3 cut(s) 147, 196, 260
AluI AGCT 3 cut(s) 147, 196, 260
AoxI GGCC 2 cut(s) 39, 284
ApeKI GCWGC 2 cut(s) 193, 257
ApoI RAATTY 1 cut(s) 166
AspA2I CCTAGG 1 cut(s) 140
AspLEI GCGC 1 cut(s) 6
AspS9I GGNCC 1 cut(s) 27
AsuHPI GGTGA 1 cut(s) 188
AsuII TTCGAA 1 cut(s) 125
AvaII GGWCC 1 cut(s) 27
AvrII CCTAGG 1 cut(s) 140
BbvI GCAGC 2 cut(s) 205, 269
BccI CCATC 1 cut(s) 331
BcgI CGANNNNNNTGC 2 cut(s) 56, 90
BfaI CTAG 1 cut(s) 141
BfuAI ACCTGC 2 cut(s) 68, 92
BisI GCNGC 2 cut(s) 194, 258
BlnI CCTAGG 1 cut(s) 140
BlsI GCNGC 2 cut(s) 195, 259
Bme18I GGWCC 1 cut(s) 27
BmgT120I GGNCC 1 cut(s) 27
BmiI GGNNCC 2 cut(s) 62, 268
BpmI CTGGAG 1 cut(s) 282
Bpu14I TTCGAA 1 cut(s) 125
BsaJI CCNNGG 1 cut(s) 140
BsaXI ACNNNNNCTCC 4 cut(s) 136, 166, 340, 370
BseDI CCNNGG 1 cut(s) 140
BseGI GGATG 1 cut(s) 342
BseRI GAGGAG 1 cut(s) 361
BseXI GCAGC 2 cut(s) 205, 269
BsgI GTGCAG 2 cut(s) 96, 120
BshFI GGCC 2 cut(s) 41, 286
BslFI GGGAC 1 cut(s) 288
BsmFI GGGAC 1 cut(s) 288
BsnI GGCC 2 cut(s) 41, 286
Bsp119I TTCGAA 1 cut(s) 125
BspACI CCGC 1 cut(s) 120
BspANI GGCC 2 cut(s) 41, 286
BspLI GGNNCC 2 cut(s) 62, 268
BspMI ACCTGC 2 cut(s) 68, 92
BspT104I TTCGAA 1 cut(s) 125
BssECI CCNNGG 1 cut(s) 140
BssT1I CCWWGG 1 cut(s) 140
Bst4CI ACNGT 1 cut(s) 211
Bst6I CTCTTC 1 cut(s) 166
BstBI TTCGAA 1 cut(s) 125
BstF5I GGATG 1 cut(s) 342
BstHHI GCGC 1 cut(s) 6
BstMWI GCNNNNNNNGC 1 cut(s) 283
BstV1I GCAGC 2 cut(s) 205, 269
BsuRI GGCC 2 cut(s) 41, 286
BtsCI GGATG 1 cut(s) 342
BtsIMutI CAGTG 1 cut(s) 115
BveI ACCTGC 2 cut(s) 68, 92
CfoI GCGC 1 cut(s) 6
Cfr13I GGNCC 1 cut(s) 27
CviAII CATG 2 cut(s) 55, 343
CviJI RGCY 6 cut(s) 41, 147, 196, 260, 286, 363
CviKI_1 RGCY 6 cut(s) 41, 147, 196, 260, 286, 363
Eam1104I CTCTTC 1 cut(s) 166
EarI CTCTTC 1 cut(s) 166
Eco130I CCWWGG 1 cut(s) 140
Eco47I GGWCC 1 cut(s) 27
EcoO109I RGGNCCY 1 cut(s) 27
EcoT14I CCWWGG 1 cut(s) 140
ErhI CCWWGG 1 cut(s) 140
FaeI CATG 2 cut(s) 58, 346
FaiI YATR 4 cut(s) 56, 93, 344, 354
FaqI GGGAC 1 cut(s) 288
FatI CATG 2 cut(s) 54, 342
Fnu4HI GCNGC 2 cut(s) 194, 258
FokI GGATG 1 cut(s) 349
Fsp4HI GCNGC 2 cut(s) 194, 258
FspBI CTAG 1 cut(s) 141
GlaI GCGC 1 cut(s) 5
GluI GCNGC 2 cut(s) 194, 258
GsuI CTGGAG 1 cut(s) 282
HaeIII GGCC 2 cut(s) 41, 286
HhaI GCGC 1 cut(s) 6
Hin1II CATG 2 cut(s) 58, 346
Hin6I GCGC 1 cut(s) 4
HinP1I GCGC 1 cut(s) 4
HincII GTYRAC 1 cut(s) 157
HindII GTYRAC 1 cut(s) 157
HpaI GTTAAC 1 cut(s) 157
HphI GGTGA 1 cut(s) 188
Hpy166II GTNNAC 2 cut(s) 133, 157
Hpy188I TCNGA 1 cut(s) 271
Hpy8I GTNNAC 2 cut(s) 133, 157
HpyAV CCTTC 2 cut(s) 276, 369
HpyCH4III ACNGT 1 cut(s) 211
HpyCH4IV ACGT 2 cut(s) 129, 301
HpyCH4V TGCA 2 cut(s) 77, 101
HpyF10VI GCNNNNNNNGC 1 cut(s) 283
HpySE526I ACGT 2 cut(s) 129, 301
Hsp92II CATG 2 cut(s) 58, 346
HspAI GCGC 1 cut(s) 4
KspAI GTTAAC 1 cut(s) 157
LmnI GCTCC 1 cut(s) 144
LpnPI CCDG 3 cut(s) 63, 87, 246
Lsp1109I GCAGC 2 cut(s) 205, 269
MaeI CTAG 1 cut(s) 141
MaeII ACGT 2 cut(s) 129, 301
MaeIII GTNAC 1 cut(s) 113
MboII GAAGA 3 cut(s) 80, 153, 250
MluCI AATT 1 cut(s) 166
MmeI TCCRAC 1 cut(s) 294
MnlI CCTC 7 cut(s) 31, 51, 74, 175, 238, 257, 339
MseI TTAA 3 cut(s) 32, 156, 206
MspA1I CMGCKG 1 cut(s) 260
MwoI GCNNNNNNNGC 1 cut(s) 283
NlaIII CATG 2 cut(s) 58, 346
NlaIV GGNNCC 2 cut(s) 62, 268
NspV TTCGAA 1 cut(s) 125
PaqCI CACCTGC 1 cut(s) 92
PkrI GCNGC 2 cut(s) 195, 259
PpuMI RGGWCCY 1 cut(s) 27
Psp1406I AACGTT 1 cut(s) 129
Psp5II RGGWCCY 1 cut(s) 27
PspN4I GGNNCC 2 cut(s) 62, 268
PspPI GGNCC 1 cut(s) 27
PspPPI RGGWCCY 1 cut(s) 27
PvuII CAGCTG 1 cut(s) 260
SaqAI TTAA 3 cut(s) 32, 156, 206
SatI GCNGC 2 cut(s) 194, 258
Sau96I GGNCC 1 cut(s) 27
SfuI TTCGAA 1 cut(s) 125
SinI GGWCC 1 cut(s) 27
Sse9I AATT 1 cut(s) 166
SsiI CCGC 1 cut(s) 120
SspMI CTAG 1 cut(s) 141
StyI CCWWGG 1 cut(s) 140
TaaI ACNGT 1 cut(s) 211
TaiI ACGT 2 cut(s) 132, 304
TaqI TCGA 3 cut(s) 66, 125, 215
TasI AATT 1 cut(s) 166
Tru1I TTAA 3 cut(s) 32, 156, 206
Tru9I TTAA 3 cut(s) 32, 156, 206
TscAI CASTG 1 cut(s) 115
TseI GCWGC 2 cut(s) 193, 257
TspDTI ATGAA 1 cut(s) 341
TspRI CASTG 1 cut(s) 115
VpaK11BI GGWCC 1 cut(s) 27
XapI RAATTY 1 cut(s) 166
XmaJI CCTAGG 1 cut(s) 140
XspI CTAG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.