Rmu_sc0002393.1_g000027

Encoded by

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002393.1
OG0000667
Physical Location & Seq
Reverse (-)
125797 .. 126188
392 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002393.1_g000027.1.cds

Sequence Viewer

Length: 321 bp
atgcgctttatttctacacccattaggaccttaacagaggctaagaacttctacatgaggaacctcgaagattgtgcaggtaaggtgggttatggtggtgcaggtaaggtggatttgaagcagctacgcaaattaaccgtttcgacaaaaaagaacaacgatgtgaagaaagagggtaacagagcagctggaggtcccgacacgcagagaaggccgattgttagagaacgtcccattgtcaaacaacgcacaatgaatagtgggatgggcatgaggagttatagtgttggcttgaaaatgggaaggattgatgaagaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

11.91

Weight (kDa)

10.36

Isoelectric Point (pI)

29.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 68, 92
AgsI TTSAA 2 cut(s) 118, 295
AluBI AGCT 2 cut(s) 124, 188
AluI AGCT 2 cut(s) 124, 188
AoxI GGCC 1 cut(s) 212
ApeKI GCWGC 2 cut(s) 121, 185
AspLEI GCGC 1 cut(s) 6
AspS9I GGNCC 2 cut(s) 27, 194
AvaII GGWCC 2 cut(s) 27, 194
BbvI GCAGC 2 cut(s) 133, 197
BccI CCATC 1 cut(s) 259
BcgI CGANNNNNNTGC 2 cut(s) 56, 90
BfuAI ACCTGC 2 cut(s) 68, 92
BisI GCNGC 2 cut(s) 122, 186
BlsI GCNGC 2 cut(s) 123, 187
Bme18I GGWCC 2 cut(s) 27, 194
BmgT120I GGNCC 2 cut(s) 27, 194
BmiI GGNNCC 2 cut(s) 62, 196
BpmI CTGGAG 1 cut(s) 210
BsaXI ACNNNNNCTCC 2 cut(s) 268, 298
BseGI GGATG 1 cut(s) 270
BseRI GAGGAG 1 cut(s) 289
BseXI GCAGC 2 cut(s) 133, 197
BsgI GTGCAG 2 cut(s) 96, 120
BshFI GGCC 1 cut(s) 214
BslFI GGGAC 2 cut(s) 180, 216
BsmFI GGGAC 2 cut(s) 180, 216
BsnI GGCC 1 cut(s) 214
BspANI GGCC 1 cut(s) 214
BspLI GGNNCC 2 cut(s) 62, 196
BspMI ACCTGC 2 cut(s) 68, 92
Bst4CI ACNGT 1 cut(s) 139
BstDEI CTNAG 1 cut(s) 42
BstF5I GGATG 1 cut(s) 270
BstHHI GCGC 1 cut(s) 6
BstMWI GCNNNNNNNGC 1 cut(s) 211
BstV1I GCAGC 2 cut(s) 133, 197
BsuRI GGCC 1 cut(s) 214
BtsCI GGATG 1 cut(s) 270
BveI ACCTGC 2 cut(s) 68, 92
CfoI GCGC 1 cut(s) 6
Cfr13I GGNCC 2 cut(s) 27, 194
CviAII CATG 2 cut(s) 55, 271
CviJI RGCY 5 cut(s) 41, 124, 188, 214, 291
CviKI_1 RGCY 5 cut(s) 41, 124, 188, 214, 291
DdeI CTNAG 1 cut(s) 42
Eco47I GGWCC 2 cut(s) 27, 194
EcoO109I RGGNCCY 2 cut(s) 27, 194
FaeI CATG 2 cut(s) 58, 274
FaiI YATR 4 cut(s) 56, 93, 272, 282
FaqI GGGAC 2 cut(s) 180, 216
FatI CATG 2 cut(s) 54, 270
Fnu4HI GCNGC 2 cut(s) 122, 186
FokI GGATG 1 cut(s) 277
Fsp4HI GCNGC 2 cut(s) 122, 186
GlaI GCGC 1 cut(s) 5
GluI GCNGC 2 cut(s) 122, 186
GsuI CTGGAG 1 cut(s) 210
HaeIII GGCC 1 cut(s) 214
HhaI GCGC 1 cut(s) 6
Hin1II CATG 2 cut(s) 58, 274
Hin6I GCGC 1 cut(s) 4
HinP1I GCGC 1 cut(s) 4
Hpy188III TCNNGA 1 cut(s) 197
HpyAV CCTTC 2 cut(s) 204, 297
HpyCH4III ACNGT 1 cut(s) 139
HpyCH4IV ACGT 1 cut(s) 229
HpyCH4V TGCA 2 cut(s) 77, 101
HpyF10VI GCNNNNNNNGC 1 cut(s) 211
HpyF3I CTNAG 1 cut(s) 42
HpySE526I ACGT 1 cut(s) 229
Hsp92II CATG 2 cut(s) 58, 274
HspAI GCGC 1 cut(s) 4
LpnPI CCDG 3 cut(s) 63, 87, 174
Lsp1109I GCAGC 2 cut(s) 133, 197
MaeII ACGT 1 cut(s) 229
MaeIII GTNAC 1 cut(s) 176
MboII GAAGA 2 cut(s) 80, 178
MluCI AATT 1 cut(s) 131
MnlI CCTC 6 cut(s) 31, 51, 74, 166, 185, 267
MseI TTAA 2 cut(s) 32, 134
MspA1I CMGCKG 1 cut(s) 188
MwoI GCNNNNNNNGC 1 cut(s) 211
NlaIII CATG 2 cut(s) 58, 274
NlaIV GGNNCC 2 cut(s) 62, 196
PkrI GCNGC 2 cut(s) 123, 187
PpuMI RGGWCCY 2 cut(s) 27, 194
Psp5II RGGWCCY 2 cut(s) 27, 194
PspN4I GGNNCC 2 cut(s) 62, 196
PspPI GGNCC 2 cut(s) 27, 194
PspPPI RGGWCCY 2 cut(s) 27, 194
PvuII CAGCTG 1 cut(s) 188
SaqAI TTAA 2 cut(s) 32, 134
SatI GCNGC 2 cut(s) 122, 186
Sau96I GGNCC 2 cut(s) 27, 194
SgeI CNNG 9 cut(s) 67, 77, 90, 114, 201, 209, 214, 283, 304
SinI GGWCC 2 cut(s) 27, 194
Sse9I AATT 1 cut(s) 131
TaaI ACNGT 1 cut(s) 139
TaiI ACGT 1 cut(s) 232
TaqI TCGA 2 cut(s) 66, 143
TasI AATT 1 cut(s) 131
Tru1I TTAA 2 cut(s) 32, 134
Tru9I TTAA 2 cut(s) 32, 134
TseI GCWGC 2 cut(s) 121, 185
TspDTI ATGAA 1 cut(s) 269
VpaK11BI GGWCC 2 cut(s) 27, 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.