Rh4DG254600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0001695
Physical Location & Seq
Reverse (-)
47002463 .. 47002657
195 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG254600.1

Sequence Viewer

Length: 195 bp
ATGTGTCCATCGCGTCCTACACCTTCTCCATTCATGGAGCTTTCTTCATGCTTCCGCCTCGTCGTGTTTGCCTTCGTTGTGGTCGTGGGCACAGTGTGTGTTGAGGGGAATCTTGGTCCTAGTGTTAGTTTATTGGAGAACCAAGAGAGTGCTGGGTCGACAGTGAAGAGTGGTAGAGGCTGTCCGGTGGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

6.69

Weight (kDa)

5.2

Isoelectric Point (pI)

49.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 158
AccII CGCG 1 cut(s) 13
AciI CCGC 1 cut(s) 55
AdeI CACNNNGTG 1 cut(s) 96
AluBI AGCT 1 cut(s) 40
AluI AGCT 1 cut(s) 40
AspS9I GGNCC 1 cut(s) 116
AvaII GGWCC 1 cut(s) 116
BaeGI GKGCMC 1 cut(s) 92
BccI CCATC 1 cut(s) 16
BfaI CTAG 1 cut(s) 120
Bme18I GGWCC 1 cut(s) 116
BmgT120I GGNCC 1 cut(s) 116
BsaWI WCCGGW 1 cut(s) 184
BsaXI ACNNNNNCTCC 2 cut(s) 10, 40
BseSI GKGCMC 1 cut(s) 92
BseYI CCCAGC 1 cut(s) 152
Bsh1236I CGCG 1 cut(s) 13
BsiSI CCGG 1 cut(s) 185
Bsp1286I GDGCHC 1 cut(s) 92
BspACI CCGC 1 cut(s) 55
BspFNI CGCG 1 cut(s) 13
Bst4CI ACNGT 2 cut(s) 94, 163
Bst6I CTCTTC 1 cut(s) 161
BstFNI CGCG 1 cut(s) 13
BstSLI GKGCMC 1 cut(s) 92
BstUI CGCG 1 cut(s) 13
BtsIMutI CAGTG 2 cut(s) 99, 168
Cfr13I GGNCC 1 cut(s) 116
CseI GACGC 1 cut(s) 2
CviAII CATG 2 cut(s) 34, 48
CviJI RGCY 2 cut(s) 40, 180
CviKI_1 RGCY 2 cut(s) 40, 180
DraIII CACNNNGTG 1 cut(s) 96
Eam1104I CTCTTC 1 cut(s) 161
EarI CTCTTC 1 cut(s) 161
EciI GGCGGA 1 cut(s) 44
Eco47I GGWCC 1 cut(s) 116
FaeI CATG 2 cut(s) 37, 51
FaiI YATR 2 cut(s) 35, 49
FatI CATG 2 cut(s) 33, 47
FblI GTMKAC 1 cut(s) 158
FspBI CTAG 1 cut(s) 120
GsaI CCCAGC 1 cut(s) 156
HapII CCGG 1 cut(s) 185
HgaI GACGC 1 cut(s) 2
Hin1II CATG 2 cut(s) 37, 51
HincII GTYRAC 1 cut(s) 159
HindII GTYRAC 1 cut(s) 159
HinfI GANTC 1 cut(s) 109
HpaII CCGG 1 cut(s) 185
Hpy166II GTNNAC 1 cut(s) 159
Hpy8I GTNNAC 1 cut(s) 159
Hpy99I CGWCG 1 cut(s) 65
HpyAV CCTTC 2 cut(s) 33, 82
HpyCH4III ACNGT 2 cut(s) 94, 163
Hsp92II CATG 2 cut(s) 37, 51
LmnI GCTCC 1 cut(s) 37
LpnPI CCDG 1 cut(s) 138
MaeI CTAG 1 cut(s) 120
MboII GAAGA 2 cut(s) 36, 178
MhlI GDGCHC 1 cut(s) 92
MnlI CCTC 3 cut(s) 68, 97, 170
MspI CCGG 1 cut(s) 185
MvnI CGCG 1 cut(s) 13
NlaIII CATG 2 cut(s) 37, 51
PcsI WCGNNNNNNNCGW 1 cut(s) 81
PfeI GAWTC 1 cut(s) 109
PspFI CCCAGC 1 cut(s) 152
PspPI GGNCC 1 cut(s) 116
SalI GTCGAC 1 cut(s) 157
Sau96I GGNCC 1 cut(s) 116
SduI GDGCHC 1 cut(s) 92
SetI ASST 2 cut(s) 25, 42
SinI GGWCC 1 cut(s) 116
SsiI CCGC 1 cut(s) 55
SspMI CTAG 1 cut(s) 120
TaaI ACNGT 2 cut(s) 94, 163
TaqI TCGA 1 cut(s) 158
TfiI GAWTC 1 cut(s) 109
TscAI CASTG 2 cut(s) 99, 168
TspDTI ATGAA 2 cut(s) 22, 36
TspRI CASTG 2 cut(s) 99, 168
VpaK11BI GGWCC 1 cut(s) 116
XcmI CCANNNNNNNNNTGG 1 cut(s) 149
XmiI GTMKAC 1 cut(s) 158
XspI CTAG 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.