Rh7AG208500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0001695
Physical Location & Seq
Forward (+)
19061137 .. 19061427
291 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG208500.1

Sequence Viewer

Length: 291 bp
ATGACTTCCTCTTTGCCTCTCTCTCCAGCTGATCCTGGTCCGTCTCCTCCTCCGATGACTTCAAGCTCAGGCCTTGGGCTTCTCACGCCCTCGATTGGAGCCGTTTCTTCGGCCCTGCTTATAAAAATGGCCTTAAGGGCAGCAACAACGCTGGAGGAAGTTGGTGGTTTTCTGGACAATGAGGAAGCAGAGGTGGTTGAAAGGTGCAAAACGGCGAGCCATTCGCAGAGGCATGACGGGCAGAAGCTGAAAATTCTCTTTCGGGTGGCAGTCGCAGGAGGTAGAGGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

9.87

Weight (kDa)

6.72

Isoelectric Point (pI)

52.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 122
AclWI GGATC 1 cut(s) 26
AcsI RAATTY 1 cut(s) 252
AfiI CCNNNNNNNGG 1 cut(s) 95
AflII CTTAAG 1 cut(s) 133
AgsI TTSAA 2 cut(s) 63, 200
AjnI CCWGG 1 cut(s) 34
AluBI AGCT 3 cut(s) 29, 66, 247
AluI AGCT 3 cut(s) 29, 66, 247
Alw26I GTCTC 1 cut(s) 48
AlwI GGATC 1 cut(s) 26
AlwNI CAGNNNCTG 1 cut(s) 247
AoxI GGCC 3 cut(s) 70, 111, 129
ApeKI GCWGC 1 cut(s) 140
ApoI RAATTY 1 cut(s) 252
ArsI GACNNNNNNTTYG 1 cut(s) 27
AspS9I GGNCC 2 cut(s) 38, 112
AvaII GGWCC 1 cut(s) 38
BbvI GCAGC 1 cut(s) 152
BceAI ACGGC 2 cut(s) 86, 228
BciT130I CCWGG 1 cut(s) 36
BcoDI GTCTC 1 cut(s) 48
BfrI CTTAAG 1 cut(s) 133
BglI GCCNNNNNGGC 1 cut(s) 137
BisI GCNGC 1 cut(s) 141
BlsI GCNGC 1 cut(s) 142
Bme1390I CCNGG 1 cut(s) 36
Bme18I GGWCC 1 cut(s) 38
BmgT120I GGNCC 2 cut(s) 38, 112
BmiI GGNNCC 1 cut(s) 100
BmrFI CCNGG 1 cut(s) 36
BpmI CTGGAG 2 cut(s) 9, 173
Bpu10I CCTNAGC 1 cut(s) 67
BsaJI CCNNGG 1 cut(s) 73
Bsc4I CCNNNNNNNGG 1 cut(s) 95
BseBI CCWGG 1 cut(s) 36
BseDI CCNNGG 1 cut(s) 73
BseLI CCNNNNNNNGG 1 cut(s) 95
BseMII CTCAG 1 cut(s) 81
BseRI GAGGAG 2 cut(s) 36, 39
BseXI GCAGC 1 cut(s) 152
BshFI GGCC 3 cut(s) 72, 113, 131
BslI CCNNNNNNNGG 1 cut(s) 95
BsmAI GTCTC 1 cut(s) 48
BsmBI CGTCTC 1 cut(s) 48
BsnI GGCC 3 cut(s) 72, 113, 131
Bsp143I GATC 1 cut(s) 31
BspANI GGCC 3 cut(s) 72, 113, 131
BspCNI CTCAG 1 cut(s) 80
BspLI GGNNCC 1 cut(s) 100
BspPI GGATC 1 cut(s) 26
BspTI CTTAAG 1 cut(s) 133
BssECI CCNNGG 1 cut(s) 73
BssMI GATC 1 cut(s) 31
BssT1I CCWWGG 1 cut(s) 73
Bst2UI CCWGG 1 cut(s) 36
BstAFI CTTAAG 1 cut(s) 133
BstC8I GCNNGC 1 cut(s) 217
BstDEI CTNAG 1 cut(s) 67
BstKTI GATC 1 cut(s) 34
BstMAI GTCTC 1 cut(s) 48
BstMBI GATC 1 cut(s) 31
BstMWI GCNNNNNNNGC 3 cut(s) 85, 137, 238
BstNI CCWGG 1 cut(s) 36
BstSCI CCNGG 1 cut(s) 34
BstV1I GCAGC 1 cut(s) 152
BsuRI GGCC 3 cut(s) 72, 113, 131
Cac8I GCNNGC 1 cut(s) 217
CaiI CAGNNNCTG 1 cut(s) 247
Cfr13I GGNCC 2 cut(s) 38, 112
CviAII CATG 1 cut(s) 233
CviJI RGCY 9 cut(s) 29, 66, 72, 79, 101, 113, 131, 219, 247
CviKI_1 RGCY 9 cut(s) 29, 66, 72, 79, 101, 113, 131, 219, 247
DdeI CTNAG 1 cut(s) 67
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
Eco130I CCWWGG 1 cut(s) 73
Eco147I AGGCCT 1 cut(s) 72
Eco47I GGWCC 1 cut(s) 38
EcoRII CCWGG 1 cut(s) 34
EcoT14I CCWWGG 1 cut(s) 73
ErhI CCWWGG 1 cut(s) 73
Esp3I CGTCTC 1 cut(s) 48
FaeI CATG 1 cut(s) 236
FaiI YATR 2 cut(s) 122, 234
FatI CATG 1 cut(s) 232
Fnu4HI GCNGC 1 cut(s) 141
Fsp4HI GCNGC 1 cut(s) 141
GluI GCNGC 1 cut(s) 141
GsuI CTGGAG 2 cut(s) 9, 173
HaeIII GGCC 3 cut(s) 72, 113, 131
Hin1II CATG 1 cut(s) 236
Hpy188I TCNGA 1 cut(s) 54
Hpy188III TCNNGA 1 cut(s) 173
HpyCH4V TGCA 1 cut(s) 207
HpyF10VI GCNNNNNNNGC 3 cut(s) 85, 137, 238
HpyF3I CTNAG 1 cut(s) 67
Hsp92II CATG 1 cut(s) 236
Kzo9I GATC 1 cut(s) 31
LmnI GCTCC 1 cut(s) 98
LpnPI CCDG 8 cut(s) 21, 39, 48, 54, 128, 137, 158, 261
Lsp1109I GCAGC 1 cut(s) 152
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MboII GAAGA 1 cut(s) 99
MluCI AATT 1 cut(s) 252
MseI TTAA 1 cut(s) 134
MspA1I CMGCKG 1 cut(s) 29
MspCI CTTAAG 1 cut(s) 133
MspR9I CCNGG 1 cut(s) 36
MvaI CCWGG 1 cut(s) 36
MwoI GCNNNNNNNGC 3 cut(s) 85, 137, 238
NdeII GATC 1 cut(s) 31
NlaIII CATG 1 cut(s) 236
NlaIV GGNNCC 1 cut(s) 100
PceI AGGCCT 1 cut(s) 72
PkrI GCNGC 1 cut(s) 142
PsiI TTATAA 1 cut(s) 122
Psp6I CCWGG 1 cut(s) 34
PspGI CCWGG 1 cut(s) 34
PspN4I GGNNCC 1 cut(s) 100
PspPI GGNCC 2 cut(s) 38, 112
PstNI CAGNNNCTG 1 cut(s) 247
PvuII CAGCTG 1 cut(s) 29
SaqAI TTAA 1 cut(s) 134
SatI GCNGC 1 cut(s) 141
Sau3AI GATC 1 cut(s) 31
Sau96I GGNCC 2 cut(s) 38, 112
ScrFI CCNGG 1 cut(s) 36
SetI ASST 6 cut(s) 31, 68, 195, 206, 249, 283
SinI GGWCC 1 cut(s) 38
SmlI CTYRAG 1 cut(s) 133
SmoI CTYRAG 1 cut(s) 133
Sse9I AATT 1 cut(s) 252
SseBI AGGCCT 1 cut(s) 72
StuI AGGCCT 1 cut(s) 72
StyD4I CCNGG 1 cut(s) 34
StyI CCWWGG 1 cut(s) 73
TaqI TCGA 1 cut(s) 92
TasI AATT 1 cut(s) 252
Tru1I TTAA 1 cut(s) 134
Tru9I TTAA 1 cut(s) 134
TseI GCWGC 1 cut(s) 140
TspGWI ACGGA 1 cut(s) 30
Vha464I CTTAAG 1 cut(s) 133
VpaK11BI GGWCC 1 cut(s) 38
XapI RAATTY 1 cut(s) 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.