FvH4_6g19722

gag-polypeptide of LTR copia-type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0000258
Physical Location & Seq
Forward (+)
13213751 .. 13214712
962 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g19722.t1

Sequence Viewer

Length: 540 bp
ATGGATGCTGCTTTGACCAAAATCCCAGATGTGTCCAAGATCGATGTTTTCAACGGCTCGTCCTTCAAAAGATGGCAAGAAAGGGTCTTCTCTTCTCTTGATGTCATGAACTATGCAGATTATCTCACCAAGGCCAAGCCCAAGGAAGGAAGTGAGGACTATGACAACTCATTGGCCAAAGCTACTCAAGTTGATGAAATGAAGGTGAAAGCTAATGTGATCGAGGAGGGTAAGTTGAAAGGTAAAAATTACAATTCTAGTTACAAATCTTTCACCAAGCGTGACAACAAATCTCACCACAAGCTTGTTAAGAATATGAAGCCTACTTACAACACAAATTTCAAAAAGAAGGGGAGTTGTTTTGTTTGTGGAAAACCAGGACACCACGCAAATGAAAGCAATAGAAGGAAGGGCAACAACCCACCTGCTCGTGCTAACTTGGTAGAATCAGATGATGAAGTCATTGTTGCGGTCATTTCTGAAGTTAATGTGGTGACTAGTGCCAAAGATTGGGTGGTAGACAAGGCACATCTGTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

180

Amino Acids

20.1

Weight (kDa)

9.29

Isoelectric Point (pI)

24.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000258)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G00980
fragaria_vesca FvH4_1g25682 FvH4_2g13961 FvH4_2g20162 FvH4_2g24753 FvH4_3g12191 FvH4_3g12632 FvH4_3g16171 FvH4_4g05871 FvH4_4g05873 FvH4_4g10121 FvH4_4g15488 FvH4_4g23911 FvH4_4g27782 FvH4_5g08912 FvH4_5g23001 FvH4_5g24552 FvH4_5g32801 FvH4_5g32802 FvH4_6g05093 FvH4_6g19722 FvH4_6g20391 FvH4_6g33792 FvH4_7g01381 FvH4_7g16761 FvH4_7g16761 FvH4_7g16761
malus_domestica MD01G1082500.v1.1 MD15G1436400.v1.1
prunus_persica Prupe.2G021400_v2.0.a1 Prupe.2G052400_v2.0.a1 Prupe.2G065000_v2.0.a1 Prupe.2G187700_v2.0.a1 Prupe.2G187800_v2.0.a1 Prupe.2G189900_v2.0.a1 Prupe.2G191300_v2.0.a1 Prupe.2G191700_v2.0.a1 Prupe.4G265600_v2.0.a1 Prupe.7G014200_v2.0.a1 Prupe.7G039000_v2.0.a1
pyrus_communis pycom01g05590 pycom01g05910 pycom02g12230 pycom02g25840 pycom03g15580 pycom04g04480 pycom05g09230 pycom05g23350 pycom05g23360 pycom07g08380 pycom09g01980 pycom09g01990 pycom11g18190 pycom11g18200 pycom11g21580 pycom13g04160 pycom15g25800 pycom16g16210 pycom16g17230 pycom16g24560 pycom16g25700 pycom17g11020
rosa_chinensis RchiOBHm_Chr1g0359981 RchiOBHm_Chr2g0151961 RchiOBHm_Chr2g0171331 RchiOBHm_Chr5g0081471 RchiOBHm_Chr6g0283031 RchiOBHm_Chr7g0197111 RchiOBHm_Chr7g0222601
rosa_laevigata RLG00000027843 RLG00000027845 RLG00000030065
rosa_multiflora Rmu_sc0000381.1_g000031 Rmu_sc0001179.1_g000035 Rmu_sc0001616.1_g000046 Rmu_sc0001851.1_g000032 Rmu_sc0002152.1_g000013 Rmu_sc0004031.1_g000015 Rmu_sc0004645.1_g000003 Rmu_sc0007393.1_g000001 Rmu_sc0008949.1_g000003 Rmu_sc0009799.1_g000011 Rmu_sc0011614.1_g000001 Rmu_sc0011699.1_g000009 Rmu_sc0019280.1_g000001 Rmu_sc0023984.1_g000001 Rmu_ssc0000050.1_g000036
rosa_roxburghii Rroxscaffold_1G00022650 Rroxscaffold_1G00033480 Rroxscaffold_3G00270250 Rroxscaffold_4G00296600 Rroxscaffold_4G00296760 Rroxscaffold_6G00409840
rosa_rugosa Rorug01G0273800 Rorug01G0273900 Rorug01G0274000
rosa_samantha Rh1AG287300 Rh1AG288100 Rh1BG253000 Rh1BG253500 Rh1BG399800 Rh1CG270400 Rh1CG271000 Rh1DG282000 Rh1DG282500 Rh4DG126500 Rh5DG194600 Rh5DG461100
rosa_wichuraiana Rw0G009130 Rw1G002590 Rw1G008490 Rw1G012210 Rw1G014290 Rw1G014490 Rw1G025510 Rw2G025840 Rw2G026170 Rw2G036510 Rw3G003050 Rw4G009270 Rw5G002350 Rw5G013930 Rw5G019500 Rw5G025890 Rw5G029960 Rw5G032360 Rw6G009890 Rw6G015670 Rw6G015860 Rw7G010030 Rw7G032600 Rw7G032770

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 433
Acc36I ACCTGC 1 cut(s) 433
AccB7I CCANNNNNTGG 1 cut(s) 510
AccI GTMKAC 1 cut(s) 519
AciI CCGC 1 cut(s) 470
AcoI YGGCCR 1 cut(s) 174
AcsI RAATTY 1 cut(s) 337
AcuI CTGAAG 1 cut(s) 501
AfiI CCNNNNNNNGG 2 cut(s) 146, 510
AgsI TTSAA 4 cut(s) 52, 67, 238, 343
AhlI ACTAGT 1 cut(s) 497
AjnI CCWGG 1 cut(s) 376
AleI CACNNNNGTG 1 cut(s) 532
AluBI AGCT 3 cut(s) 182, 212, 304
AluI AGCT 3 cut(s) 182, 212, 304
AoxI GGCC 2 cut(s) 132, 174
ApeKI GCWGC 1 cut(s) 8
ApoI RAATTY 1 cut(s) 337
AsuHPI GGTGA 5 cut(s) 118, 217, 265, 287, 505
BalI TGGCCA 1 cut(s) 176
BarI GAAGNNNNNNTAC 2 cut(s) 311, 343
BauI CACGAG 1 cut(s) 429
BbsI GAAGAC 1 cut(s) 79
BccI CCATC 1 cut(s) 66
BceAI ACGGC 1 cut(s) 70
BciT130I CCWGG 1 cut(s) 378
BcuI ACTAGT 1 cut(s) 497
BfaI CTAG 2 cut(s) 258, 498
BfuAI ACCTGC 1 cut(s) 433
BisI GCNGC 1 cut(s) 9
BlsI GCNGC 1 cut(s) 10
Bme1390I CCNGG 1 cut(s) 378
BmrFI CCNGG 1 cut(s) 378
BpiI GAAGAC 1 cut(s) 79
BpuEI CTTGAG 1 cut(s) 171
Bsa29I ATCGAT 1 cut(s) 42
BsaJI CCNNGG 2 cut(s) 129, 141
BsaXI ACNNNNNCTCC 2 cut(s) 218, 248
Bsc4I CCNNNNNNNGG 2 cut(s) 146, 510
BseBI CCWGG 1 cut(s) 378
BseCI ATCGAT 1 cut(s) 42
BseDI CCNNGG 2 cut(s) 129, 141
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 2 cut(s) 146, 510
BseRI GAGGAG 1 cut(s) 239
BshFI GGCC 2 cut(s) 134, 176
BshVI ATCGAT 1 cut(s) 42
BslI CCNNNNNNNGG 2 cut(s) 146, 510
BsnI GGCC 2 cut(s) 134, 176
Bsp143I GATC 2 cut(s) 39, 219
BspACI CCGC 1 cut(s) 470
BspANI GGCC 2 cut(s) 134, 176
BspDI ATCGAT 1 cut(s) 42
BspHI TCATGA 1 cut(s) 105
BspMI ACCTGC 1 cut(s) 433
BssECI CCNNGG 2 cut(s) 129, 141
BssMI GATC 2 cut(s) 39, 219
BssSI CACGAG 1 cut(s) 429
BssT1I CCWWGG 2 cut(s) 129, 141
Bst2BI CACGAG 1 cut(s) 429
Bst2UI CCWGG 1 cut(s) 378
Bst6I CTCTTC 1 cut(s) 97
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 2 cut(s) 42, 222
BstMBI GATC 2 cut(s) 39, 219
BstNI CCWGG 1 cut(s) 378
BstSCI CCNGG 1 cut(s) 376
BstV2I GAAGAC 1 cut(s) 79
Bsu15I ATCGAT 1 cut(s) 42
BsuRI GGCC 2 cut(s) 134, 176
BsuTUI ATCGAT 1 cut(s) 42
BtsCI GGATG 1 cut(s) 10
BveI ACCTGC 1 cut(s) 433
CciI TCATGA 1 cut(s) 105
ClaI ATCGAT 1 cut(s) 42
CviAII CATG 1 cut(s) 106
CviJI RGCY 8 cut(s) 57, 134, 139, 176, 182, 212, 304, 322
CviKI_1 RGCY 8 cut(s) 57, 134, 139, 176, 182, 212, 304, 322
DpnI GATC 2 cut(s) 41, 221
DpnII GATC 2 cut(s) 39, 219
EaeI YGGCCR 1 cut(s) 174
Eam1104I CTCTTC 1 cut(s) 97
EarI CTCTTC 1 cut(s) 97
Eco130I CCWWGG 2 cut(s) 129, 141
Eco57I CTGAAG 1 cut(s) 501
EcoRII CCWGG 1 cut(s) 376
EcoT14I CCWWGG 2 cut(s) 129, 141
ErhI CCWWGG 2 cut(s) 129, 141
FaeI CATG 1 cut(s) 109
FaiI YATR 4 cut(s) 107, 114, 162, 317
FatI CATG 1 cut(s) 105
FblI GTMKAC 1 cut(s) 519
Fnu4HI GCNGC 1 cut(s) 9
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 1 cut(s) 9
FspBI CTAG 2 cut(s) 258, 498
GluI GCNGC 1 cut(s) 9
HaeIII GGCC 2 cut(s) 134, 176
Hin1II CATG 1 cut(s) 109
HindIII AAGCTT 1 cut(s) 302
HinfI GANTC 1 cut(s) 446
HphI GGTGA 5 cut(s) 118, 217, 265, 287, 505
Hpy166II GTNNAC 1 cut(s) 520
Hpy188I TCNGA 2 cut(s) 451, 481
Hpy188III TCNNGA 2 cut(s) 98, 106
Hpy8I GTNNAC 1 cut(s) 520
HpyAV CCTTC 6 cut(s) 73, 140, 196, 343, 399, 403
HpyCH4V TGCA 1 cut(s) 116
Hsp92II CATG 1 cut(s) 109
Kzo9I GATC 2 cut(s) 39, 219
LpnPI CCDG 4 cut(s) 39, 363, 390, 438
MaeI CTAG 2 cut(s) 258, 498
MaeIII GTNAC 3 cut(s) 260, 281, 493
MalI GATC 2 cut(s) 41, 221
MboI GATC 2 cut(s) 39, 219
MboII GAAGA 2 cut(s) 79, 84
MlsI TGGCCA 1 cut(s) 176
MluCI AATT 3 cut(s) 247, 253, 337
MluNI TGGCCA 1 cut(s) 176
MnlI CCTC 3 cut(s) 148, 217, 220
Mox20I TGGCCA 1 cut(s) 176
MscI TGGCCA 1 cut(s) 176
MseI TTAA 2 cut(s) 309, 486
MslI CAYNNNNRTG 2 cut(s) 390, 532
Msp20I TGGCCA 1 cut(s) 176
MspR9I CCNGG 1 cut(s) 378
MvaI CCWGG 1 cut(s) 378
NdeII GATC 2 cut(s) 39, 219
NlaIII CATG 1 cut(s) 109
NmuCI GTSAC 2 cut(s) 281, 493
OliI CACNNNNGTG 1 cut(s) 532
PagI TCATGA 1 cut(s) 105
PaqCI CACCTGC 1 cut(s) 433
PfeI GAWTC 1 cut(s) 446
PflMI CCANNNNNTGG 1 cut(s) 510
PkrI GCNGC 1 cut(s) 10
Psp6I CCWGG 1 cut(s) 376
PspGI CCWGG 1 cut(s) 376
RseI CAYNNNNRTG 2 cut(s) 390, 532
SaqAI TTAA 2 cut(s) 309, 486
SatI GCNGC 1 cut(s) 9
Sau3AI GATC 2 cut(s) 39, 219
ScrFI CCNGG 1 cut(s) 378
SetI ASST 6 cut(s) 184, 207, 214, 244, 306, 427
SmiMI CAYNNNNRTG 2 cut(s) 390, 532
SmlI CTYRAG 1 cut(s) 186
SmoI CTYRAG 1 cut(s) 186
SpeI ACTAGT 1 cut(s) 497
Sse9I AATT 3 cut(s) 247, 253, 337
SsiI CCGC 1 cut(s) 470
SspMI CTAG 2 cut(s) 258, 498
StyD4I CCNGG 1 cut(s) 376
StyI CCWWGG 2 cut(s) 129, 141
TaqI TCGA 2 cut(s) 42, 222
TasI AATT 3 cut(s) 247, 253, 337
TfiI GAWTC 1 cut(s) 446
Tru1I TTAA 2 cut(s) 309, 486
Tru9I TTAA 2 cut(s) 309, 486
TseFI GTSAC 2 cut(s) 281, 493
TseI GCWGC 1 cut(s) 8
Tsp45I GTSAC 2 cut(s) 281, 493
TspDTI ATGAA 6 cut(s) 122, 210, 215, 332, 408, 471
Van91I CCANNNNNTGG 1 cut(s) 510
XapI RAATTY 1 cut(s) 337
XcmI CCANNNNNNNNNTGG 1 cut(s) 511
XmiI GTMKAC 1 cut(s) 519
XspI CTAG 2 cut(s) 258, 498
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.