Rmu_sc0004645.1_g000003

gag-polypeptide of LTR copia-type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004645.1
OG0000258
Physical Location & Seq
Forward (+)
9214 .. 9552
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004645.1_g000003.1.cds

Sequence Viewer

Length: 339 bp
atgtatgattctgtatttcagatggatcaatcggcggtggtcgctaaaacctctcatgctgagaaaccagaaaagttcaagggtgtcgattttaagagatggcaacagaaaatgttgttctatctcacaaccttgaagttggcacatgtggtcacgcaagagaaaccagtggcagaacttccagcgactatggagacaatgaatgccatagacgcttgggtccatagcgaatttctgtgcaggaactacatccttaatggactggaaaatacgctttatgatgtcaaccatctcaaaactatgatgaaaataaacatatattctaataatgaaaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

13.09

Weight (kDa)

6.9

Isoelectric Point (pI)

39.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000258)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G00980
fragaria_vesca FvH4_1g25682 FvH4_2g13961 FvH4_2g20162 FvH4_2g24753 FvH4_3g12191 FvH4_3g12632 FvH4_3g16171 FvH4_4g05871 FvH4_4g05873 FvH4_4g10121 FvH4_4g15488 FvH4_4g23911 FvH4_4g27782 FvH4_5g08912 FvH4_5g23001 FvH4_5g24552 FvH4_5g32801 FvH4_5g32802 FvH4_6g05093 FvH4_6g19722 FvH4_6g20391 FvH4_6g33792 FvH4_7g01381 FvH4_7g16761 FvH4_7g16761 FvH4_7g16761
malus_domestica MD01G1082500.v1.1 MD15G1436400.v1.1
prunus_persica Prupe.2G021400_v2.0.a1 Prupe.2G052400_v2.0.a1 Prupe.2G065000_v2.0.a1 Prupe.2G187700_v2.0.a1 Prupe.2G187800_v2.0.a1 Prupe.2G189900_v2.0.a1 Prupe.2G191300_v2.0.a1 Prupe.2G191700_v2.0.a1 Prupe.4G265600_v2.0.a1 Prupe.7G014200_v2.0.a1 Prupe.7G039000_v2.0.a1
pyrus_communis pycom01g05590 pycom01g05910 pycom02g12230 pycom02g25840 pycom03g15580 pycom04g04480 pycom05g09230 pycom05g23350 pycom05g23360 pycom07g08380 pycom09g01980 pycom09g01990 pycom11g18190 pycom11g18200 pycom11g21580 pycom13g04160 pycom15g25800 pycom16g16210 pycom16g17230 pycom16g24560 pycom16g25700 pycom17g11020
rosa_chinensis RchiOBHm_Chr1g0359981 RchiOBHm_Chr2g0151961 RchiOBHm_Chr2g0171331 RchiOBHm_Chr5g0081471 RchiOBHm_Chr6g0283031 RchiOBHm_Chr7g0197111 RchiOBHm_Chr7g0222601
rosa_laevigata RLG00000027843 RLG00000027845 RLG00000030065
rosa_multiflora Rmu_sc0000381.1_g000031 Rmu_sc0001179.1_g000035 Rmu_sc0001616.1_g000046 Rmu_sc0001851.1_g000032 Rmu_sc0002152.1_g000013 Rmu_sc0004031.1_g000015 Rmu_sc0004645.1_g000003 Rmu_sc0007393.1_g000001 Rmu_sc0008949.1_g000003 Rmu_sc0009799.1_g000011 Rmu_sc0011614.1_g000001 Rmu_sc0011699.1_g000009 Rmu_sc0019280.1_g000001 Rmu_sc0023984.1_g000001 Rmu_ssc0000050.1_g000036
rosa_roxburghii Rroxscaffold_1G00022650 Rroxscaffold_1G00033480 Rroxscaffold_3G00270250 Rroxscaffold_4G00296600 Rroxscaffold_4G00296760 Rroxscaffold_6G00409840
rosa_rugosa Rorug01G0273800 Rorug01G0273900 Rorug01G0274000
rosa_samantha Rh1AG287300 Rh1AG288100 Rh1BG253000 Rh1BG253500 Rh1BG399800 Rh1CG270400 Rh1CG271000 Rh1DG282000 Rh1DG282500 Rh4DG126500 Rh5DG194600 Rh5DG461100
rosa_wichuraiana Rw0G009130 Rw1G002590 Rw1G008490 Rw1G012210 Rw1G014290 Rw1G014490 Rw1G025510 Rw2G025840 Rw2G026170 Rw2G036510 Rw3G003050 Rw4G009270 Rw5G002350 Rw5G013930 Rw5G019500 Rw5G025890 Rw5G029960 Rw5G032360 Rw6G009890 Rw6G015670 Rw6G015860 Rw7G010030 Rw7G032600 Rw7G032770

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 218
AciI CCGC 1 cut(s) 35
AclWI GGATC 1 cut(s) 33
AcsI RAATTY 1 cut(s) 230
AflIII ACRYGT 1 cut(s) 145
AgsI TTSAA 2 cut(s) 79, 136
Alw26I GTCTC 1 cut(s) 188
AlwI GGATC 1 cut(s) 33
ApoI RAATTY 1 cut(s) 230
AspS9I GGNCC 1 cut(s) 220
AvaII GGWCC 1 cut(s) 220
BccI CCATC 3 cut(s) 16, 93, 297
BcoDI GTCTC 1 cut(s) 188
Bme18I GGWCC 1 cut(s) 220
BmgT120I GGNCC 1 cut(s) 220
BmiI GGNNCC 1 cut(s) 221
Bse1I ACTGG 2 cut(s) 167, 267
BseGI GGATG 1 cut(s) 249
BseMII CTCAG 1 cut(s) 51
BseNI ACTGG 2 cut(s) 167, 267
BsgI GTGCAG 1 cut(s) 259
BsmAI GTCTC 1 cut(s) 188
BsmI GAATGC 1 cut(s) 208
Bsp143I GATC 1 cut(s) 25
BspACI CCGC 1 cut(s) 35
BspCNI CTCAG 1 cut(s) 52
BspLI GGNNCC 1 cut(s) 221
BspPI GGATC 1 cut(s) 33
BsrI ACTGG 2 cut(s) 167, 267
BssMI GATC 1 cut(s) 25
BstDEI CTNAG 1 cut(s) 60
BstF5I GGATG 1 cut(s) 249
BstKTI GATC 1 cut(s) 28
BstMAI GTCTC 1 cut(s) 188
BstMBI GATC 1 cut(s) 25
BstMWI GCNNNNNNNGC 2 cut(s) 41, 212
BstNSI RCATGY 1 cut(s) 149
BtsCI GGATG 1 cut(s) 249
BtsIMutI CAGTG 1 cut(s) 174
Cfr13I GGNCC 1 cut(s) 220
CseI GACGC 1 cut(s) 221
CviAII CATG 2 cut(s) 56, 146
DdeI CTNAG 1 cut(s) 60
DpnI GATC 1 cut(s) 27
DpnII GATC 1 cut(s) 25
DrdI GACNNNNNNGTC 1 cut(s) 218
DseDI GACNNNNNNGTC 1 cut(s) 218
Eco47I GGWCC 1 cut(s) 220
FaeI CATG 2 cut(s) 59, 149
FatI CATG 2 cut(s) 55, 145
FokI GGATG 1 cut(s) 236
HgaI GACGC 1 cut(s) 221
Hin1II CATG 2 cut(s) 59, 149
HincII GTYRAC 1 cut(s) 286
HindII GTYRAC 1 cut(s) 286
HinfI GANTC 1 cut(s) 8
Hpy166II GTNNAC 1 cut(s) 286
Hpy188I TCNGA 1 cut(s) 21
Hpy8I GTNNAC 1 cut(s) 286
HpyCH4V TGCA 1 cut(s) 240
HpyF10VI GCNNNNNNNGC 2 cut(s) 41, 212
HpyF3I CTNAG 1 cut(s) 60
Hsp92II CATG 2 cut(s) 59, 149
Kzo9I GATC 1 cut(s) 25
LpnPI CCDG 5 cut(s) 81, 180, 195, 226, 248
MaeIII GTNAC 1 cut(s) 151
MalI GATC 1 cut(s) 27
MboI GATC 1 cut(s) 25
MluCI AATT 1 cut(s) 230
MnlI CCTC 1 cut(s) 61
MseI TTAA 2 cut(s) 93, 255
Mva1269I GAATGC 1 cut(s) 208
MwoI GCNNNNNNNGC 2 cut(s) 41, 212
NdeII GATC 1 cut(s) 25
NlaIII CATG 2 cut(s) 59, 149
NlaIV GGNNCC 1 cut(s) 221
NmuCI GTSAC 1 cut(s) 151
NspI RCATGY 1 cut(s) 149
PciI ACATGT 1 cut(s) 145
PctI GAATGC 1 cut(s) 208
PfeI GAWTC 1 cut(s) 8
PscI ACATGT 1 cut(s) 145
PspN4I GGNNCC 1 cut(s) 221
PspPI GGNCC 1 cut(s) 220
SaqAI TTAA 2 cut(s) 93, 255
Sau3AI GATC 1 cut(s) 25
Sau96I GGNCC 1 cut(s) 220
SetI ASST 2 cut(s) 53, 134
SinI GGWCC 1 cut(s) 220
Sse9I AATT 1 cut(s) 230
SsiI CCGC 1 cut(s) 35
TaqI TCGA 1 cut(s) 87
TasI AATT 1 cut(s) 230
TfiI GAWTC 1 cut(s) 8
Tru1I TTAA 2 cut(s) 93, 255
Tru9I TTAA 2 cut(s) 93, 255
TscAI CASTG 1 cut(s) 174
TseFI GTSAC 1 cut(s) 151
Tsp45I GTSAC 1 cut(s) 151
TspDTI ATGAA 2 cut(s) 215, 320
TspRI CASTG 1 cut(s) 174
VpaK11BI GGWCC 1 cut(s) 220
XapI RAATTY 1 cut(s) 230
XceI RCATGY 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.