Rmu_sc0001851.1_g000032

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001851.1
Physical Location & Seq
Reverse (-)
177744 .. 178106
363 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001851.1_g000032.1.cds

Sequence Viewer

Length: 363 bp
atggatgctgctatgaccaacaccaagatcccagatgtttctaagatcgatgttttcaatggctcgttcttcaaaagatggcaagaaagagtcttctctgctcttgatgtcatgaatctggcagattatctcacgaaggccaagcccaaggaaggtagcgagaattataacaaagagtcggctgaatgggagaaaggtaacaaaaattgtaggcatactattatgagcacactttcaaatgagctttttgatatatattgtgcctacaggcctgctgctgaaatttgggagattctcataaaaaagtacgtgactgaagatgctggaacccagcaattgggaattttcttaaatttcaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

13.87

Weight (kDa)

5.85

Isoelectric Point (pI)

26.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000258)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G00980
fragaria_vesca FvH4_1g25682 FvH4_2g13961 FvH4_2g20162 FvH4_2g24753 FvH4_3g12191 FvH4_3g12632 FvH4_3g16171 FvH4_4g05871 FvH4_4g05873 FvH4_4g10121 FvH4_4g15488 FvH4_4g23911 FvH4_4g27782 FvH4_5g08912 FvH4_5g23001 FvH4_5g24552 FvH4_5g32801 FvH4_5g32802 FvH4_6g05093 FvH4_6g19722 FvH4_6g20391 FvH4_6g33792 FvH4_7g01381 FvH4_7g16761 FvH4_7g16761 FvH4_7g16761
malus_domestica MD01G1082500.v1.1 MD15G1436400.v1.1
prunus_persica Prupe.2G021400_v2.0.a1 Prupe.2G052400_v2.0.a1 Prupe.2G065000_v2.0.a1 Prupe.2G187700_v2.0.a1 Prupe.2G187800_v2.0.a1 Prupe.2G189900_v2.0.a1 Prupe.2G191300_v2.0.a1 Prupe.2G191700_v2.0.a1 Prupe.4G265600_v2.0.a1 Prupe.7G014200_v2.0.a1 Prupe.7G039000_v2.0.a1
pyrus_communis pycom01g05590 pycom01g05910 pycom02g12230 pycom02g25840 pycom03g15580 pycom04g04480 pycom05g09230 pycom05g23350 pycom05g23360 pycom07g08380 pycom09g01980 pycom09g01990 pycom11g18190 pycom11g18200 pycom11g21580 pycom13g04160 pycom15g25800 pycom16g16210 pycom16g17230 pycom16g24560 pycom16g25700 pycom17g11020
rosa_chinensis RchiOBHm_Chr1g0359981 RchiOBHm_Chr2g0151961 RchiOBHm_Chr2g0171331 RchiOBHm_Chr5g0081471 RchiOBHm_Chr6g0283031 RchiOBHm_Chr7g0197111 RchiOBHm_Chr7g0222601
rosa_laevigata RLG00000027843 RLG00000027845 RLG00000030065
rosa_multiflora Rmu_sc0000381.1_g000031 Rmu_sc0001179.1_g000035 Rmu_sc0001616.1_g000046 Rmu_sc0001851.1_g000032 Rmu_sc0002152.1_g000013 Rmu_sc0004031.1_g000015 Rmu_sc0004645.1_g000003 Rmu_sc0007393.1_g000001 Rmu_sc0008949.1_g000003 Rmu_sc0009799.1_g000011 Rmu_sc0011614.1_g000001 Rmu_sc0011699.1_g000009 Rmu_sc0019280.1_g000001 Rmu_sc0023984.1_g000001 Rmu_ssc0000050.1_g000036
rosa_roxburghii Rroxscaffold_1G00022650 Rroxscaffold_1G00033480 Rroxscaffold_3G00270250 Rroxscaffold_4G00296600 Rroxscaffold_4G00296760 Rroxscaffold_6G00409840
rosa_rugosa Rorug01G0273800 Rorug01G0273900 Rorug01G0274000
rosa_samantha Rh1AG287300 Rh1AG288100 Rh1BG253000 Rh1BG253500 Rh1BG399800 Rh1CG270400 Rh1CG271000 Rh1DG282000 Rh1DG282500 Rh4DG126500 Rh5DG194600 Rh5DG461100
rosa_wichuraiana Rw0G009130 Rw1G002590 Rw1G008490 Rw1G012210 Rw1G014290 Rw1G014490 Rw1G025510 Rw2G025840 Rw2G026170 Rw2G036510 Rw3G003050 Rw4G009270 Rw5G002350 Rw5G013930 Rw5G019500 Rw5G025890 Rw5G029960 Rw5G032360 Rw6G009890 Rw6G015670 Rw6G015860 Rw7G010030 Rw7G032600 Rw7G032770

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 168
AccB7I CCANNNNNTGG 1 cut(s) 337
AclWI GGATC 1 cut(s) 22
AcsI RAATTY 3 cut(s) 282, 342, 352
AcuI CTGAAG 1 cut(s) 336
AfaI GTAC 1 cut(s) 308
AfiI CCNNNNNNNGG 2 cut(s) 152, 337
AgsI TTSAA 4 cut(s) 58, 73, 237, 358
AluBI AGCT 1 cut(s) 244
AluI AGCT 1 cut(s) 244
Alw21I GWGCWC 1 cut(s) 230
AlwI GGATC 1 cut(s) 22
AoxI GGCC 2 cut(s) 138, 269
ApeKI GCWGC 2 cut(s) 8, 275
ApoI RAATTY 3 cut(s) 282, 342, 352
BbsI GAAGAC 1 cut(s) 85
Bbv12I GWGCWC 1 cut(s) 230
BbvI GCAGC 1 cut(s) 262
BccI CCATC 1 cut(s) 72
BfmI CTRYAG 1 cut(s) 265
BisI GCNGC 2 cut(s) 9, 276
BlsI GCNGC 2 cut(s) 10, 277
BmiI GGNNCC 1 cut(s) 328
BmsI GCATC 1 cut(s) 310
BpiI GAAGAC 1 cut(s) 85
Bsa29I ATCGAT 1 cut(s) 48
BsaAI YACGTR 1 cut(s) 310
BsaJI CCNNGG 1 cut(s) 147
Bsc4I CCNNNNNNNGG 2 cut(s) 152, 337
BseCI ATCGAT 1 cut(s) 48
BseDI CCNNGG 1 cut(s) 147
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 2 cut(s) 152, 337
BseXI GCAGC 1 cut(s) 262
BseYI CCCAGC 1 cut(s) 330
BshFI GGCC 2 cut(s) 140, 271
BshVI ATCGAT 1 cut(s) 48
BsiHKAI GWGCWC 1 cut(s) 230
BslI CCNNNNNNNGG 2 cut(s) 152, 337
BsnI GGCC 2 cut(s) 140, 271
Bsp1286I GDGCHC 1 cut(s) 230
Bsp143I GATC 2 cut(s) 27, 45
BspANI GGCC 2 cut(s) 140, 271
BspDI ATCGAT 1 cut(s) 48
BspHI TCATGA 1 cut(s) 111
BspLI GGNNCC 1 cut(s) 328
BspPI GGATC 1 cut(s) 22
BssECI CCNNGG 1 cut(s) 147
BssMI GATC 2 cut(s) 27, 45
BssT1I CCWWGG 1 cut(s) 147
BstBAI YACGTR 1 cut(s) 310
BstC8I GCNNGC 1 cut(s) 273
BstDEI CTNAG 1 cut(s) 42
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 2 cut(s) 30, 48
BstMBI GATC 2 cut(s) 27, 45
BstSFI CTRYAG 1 cut(s) 265
BstV1I GCAGC 1 cut(s) 262
BstV2I GAAGAC 1 cut(s) 85
BstX2I RGATCY 1 cut(s) 27
BstYI RGATCY 1 cut(s) 27
Bsu15I ATCGAT 1 cut(s) 48
BsuRI GGCC 2 cut(s) 140, 271
BsuTUI ATCGAT 1 cut(s) 48
BtsCI GGATG 1 cut(s) 10
Cac8I GCNNGC 1 cut(s) 273
CciI TCATGA 1 cut(s) 111
ClaI ATCGAT 1 cut(s) 48
Csp6I GTAC 1 cut(s) 307
CviAII CATG 1 cut(s) 112
CviJI RGCY 6 cut(s) 63, 140, 145, 182, 244, 271
CviKI_1 RGCY 6 cut(s) 63, 140, 145, 182, 244, 271
CviQI GTAC 1 cut(s) 307
DdeI CTNAG 1 cut(s) 42
DpnI GATC 2 cut(s) 29, 47
DpnII GATC 2 cut(s) 27, 45
Eco130I CCWWGG 1 cut(s) 147
Eco147I AGGCCT 1 cut(s) 271
Eco57I CTGAAG 1 cut(s) 336
EcoT14I CCWWGG 1 cut(s) 147
ErhI CCWWGG 1 cut(s) 147
FaeI CATG 1 cut(s) 115
FaiI YATR 8 cut(s) 14, 113, 168, 216, 224, 254, 256, 299
FatI CATG 1 cut(s) 111
Fnu4HI GCNGC 2 cut(s) 9, 276
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 2 cut(s) 9, 276
GluI GCNGC 2 cut(s) 9, 276
GsaI CCCAGC 1 cut(s) 334
HaeIII GGCC 2 cut(s) 140, 271
Hin1II CATG 1 cut(s) 115
HinfI GANTC 4 cut(s) 90, 115, 176, 292
Hpy188III TCNNGA 3 cut(s) 104, 112, 133
HpyAV CCTTC 2 cut(s) 130, 146
HpyCH4IV ACGT 1 cut(s) 309
HpyF3I CTNAG 1 cut(s) 42
HpySE526I ACGT 1 cut(s) 309
Hsp92II CATG 1 cut(s) 115
Kzo9I GATC 2 cut(s) 27, 45
LpnPI CCDG 6 cut(s) 45, 104, 253, 285, 309, 344
Lsp1109I GCAGC 1 cut(s) 262
LweI GCATC 1 cut(s) 310
MaeII ACGT 1 cut(s) 309
MaeIII GTNAC 2 cut(s) 197, 310
MalI GATC 2 cut(s) 29, 47
MboI GATC 2 cut(s) 27, 45
MboII GAAGA 3 cut(s) 61, 85, 329
MfeI CAATTG 1 cut(s) 335
MflI RGATCY 1 cut(s) 27
MhlI GDGCHC 1 cut(s) 230
MluCI AATT 6 cut(s) 163, 205, 282, 335, 342, 352
MlyI GAGTC 2 cut(s) 99, 185
MseI TTAA 1 cut(s) 350
MunI CAATTG 1 cut(s) 335
NdeII GATC 2 cut(s) 27, 45
NlaIII CATG 1 cut(s) 115
NlaIV GGNNCC 1 cut(s) 328
NmuCI GTSAC 1 cut(s) 310
PagI TCATGA 1 cut(s) 111
PceI AGGCCT 1 cut(s) 271
PfeI GAWTC 2 cut(s) 115, 292
PflMI CCANNNNNTGG 1 cut(s) 337
PkrI GCNGC 2 cut(s) 10, 277
PleI GAGTC 2 cut(s) 98, 184
PpsI GAGTC 2 cut(s) 98, 184
Ppu21I YACGTR 1 cut(s) 310
PsiI TTATAA 1 cut(s) 168
PspFI CCCAGC 1 cut(s) 330
PspN4I GGNNCC 1 cut(s) 328
PsuI RGATCY 1 cut(s) 27
RsaI GTAC 1 cut(s) 308
RsaNI GTAC 1 cut(s) 307
SaqAI TTAA 1 cut(s) 350
SatI GCNGC 2 cut(s) 9, 276
Sau3AI GATC 2 cut(s) 27, 45
SchI GAGTC 2 cut(s) 99, 185
SduI GDGCHC 1 cut(s) 230
SetI ASST 4 cut(s) 157, 199, 246, 312
SfaNI GCATC 1 cut(s) 310
SfcI CTRYAG 1 cut(s) 265
Sse9I AATT 6 cut(s) 163, 205, 282, 335, 342, 352
SseBI AGGCCT 1 cut(s) 271
StuI AGGCCT 1 cut(s) 271
StyI CCWWGG 1 cut(s) 147
TaiI ACGT 1 cut(s) 312
TaqI TCGA 1 cut(s) 48
TasI AATT 6 cut(s) 163, 205, 282, 335, 342, 352
TfiI GAWTC 2 cut(s) 115, 292
Tru1I TTAA 1 cut(s) 350
Tru9I TTAA 1 cut(s) 350
TseFI GTSAC 1 cut(s) 310
TseI GCWGC 2 cut(s) 8, 275
Tsp45I GTSAC 1 cut(s) 310
TspDTI ATGAA 1 cut(s) 128
Van91I CCANNNNNTGG 1 cut(s) 337
XapI RAATTY 3 cut(s) 282, 342, 352
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.