MD06G1158700.v1.1

3'-UTR-mediated mRNA destabilization

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
Physical Location & Seq
Reverse (-)
30039826 .. 30045103
5278 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1158700.v1.1.491

Sequence Viewer

Length: 507 bp
ATGCAGGGGGAAGAGTTGACAGAGAAGCAAGACCAGAGTGAAAGCAGGGAAATATTTGTTGGTGATCATTTTGTGTTGAAGGTGTCTAAGGACAAGGCAAAGCGGAGGGAAGAGTTGGCAGAAAAGCAAGACCAGACCGAAAACAAGAAGATGGTGTCTAAGGACAAGGCAAAGCAACGCGAAGAGTTGGCAGAGAAGCAAGTCCAGACCGAAAGCAAGAATGTGTCTAAGGACAAGGCAAAGCGGAGGGAAGAGTTGGCAGTGAAGCAAGACCAGACCGAAAGCAAGGTGTTTAAGGACAAGCCAAGGCAGAGGGGAGAGTTGGCAGAGAAGCAAGGCCAGACCAAAAACAAGGTGTTTAAGGACAATGCAAAGCAGAGGGGAGAGTTGGCAGAGAAGCAAGGCCAGACCAGAAACAAGTATTGCCCAGGACAACGTAAAAGGGAACCCTCTGTAGCTCCAGCTCTGAAACTTAACTTTTTGGGCCTGCCAATTCGTCCGGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

169

Amino Acids

19.46

Weight (kDa)

9.71

Isoelectric Point (pI)

63.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 180
AciI CCGC 2 cut(s) 103, 244
AgsI TTSAA 1 cut(s) 79
AjnI CCWGG 1 cut(s) 427
AjuI GAANNNNNNNTTGG 2 cut(s) 42, 74
AluBI AGCT 2 cut(s) 458, 464
AluI AGCT 2 cut(s) 458, 464
AoxI GGCC 3 cut(s) 337, 403, 484
AspS9I GGNCC 1 cut(s) 484
AsuHPI GGTGA 1 cut(s) 74
BccI CCATC 1 cut(s) 145
BciT130I CCWGG 1 cut(s) 429
BclI TGATCA 1 cut(s) 64
BfmI CTRYAG 1 cut(s) 453
Bme1390I CCNGG 1 cut(s) 429
BmgT120I GGNCC 1 cut(s) 484
BmiI GGNNCC 1 cut(s) 447
BmrFI CCNGG 1 cut(s) 429
BpmI CTGGAG 1 cut(s) 444
BsaJI CCNNGG 2 cut(s) 305, 427
BsaWI WCCGGW 1 cut(s) 499
BseBI CCWGG 1 cut(s) 429
BseDI CCNNGG 2 cut(s) 305, 427
Bsh1236I CGCG 1 cut(s) 180
BshFI GGCC 3 cut(s) 339, 405, 486
BsiSI CCGG 1 cut(s) 500
BsnI GGCC 3 cut(s) 339, 405, 486
Bsp143I GATC 1 cut(s) 64
BspACI CCGC 2 cut(s) 103, 244
BspANI GGCC 3 cut(s) 339, 405, 486
BspFNI CGCG 1 cut(s) 180
BspLI GGNNCC 1 cut(s) 447
BssECI CCNNGG 2 cut(s) 305, 427
BssMI GATC 1 cut(s) 64
BssT1I CCWWGG 1 cut(s) 305
Bst2UI CCWGG 1 cut(s) 429
Bst6I CTCTTC 4 cut(s) 6, 105, 177, 246
BstC8I GCNNGC 1 cut(s) 488
BstDEI CTNAG 3 cut(s) 87, 159, 228
BstFNI CGCG 1 cut(s) 180
BstKTI GATC 1 cut(s) 67
BstMBI GATC 1 cut(s) 64
BstNI CCWGG 1 cut(s) 429
BstSCI CCNGG 1 cut(s) 427
BstSFI CTRYAG 1 cut(s) 453
BstUI CGCG 1 cut(s) 180
BsuRI GGCC 3 cut(s) 339, 405, 486
BtsI GCAGTG 1 cut(s) 267
BtsIMutI CAGTG 1 cut(s) 267
Cac8I GCNNGC 1 cut(s) 488
Cfr13I GGNCC 1 cut(s) 484
CviJI RGCY 6 cut(s) 304, 339, 405, 458, 464, 486
CviKI_1 RGCY 6 cut(s) 304, 339, 405, 458, 464, 486
DdeI CTNAG 3 cut(s) 87, 159, 228
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
Eam1104I CTCTTC 4 cut(s) 6, 105, 177, 246
EarI CTCTTC 4 cut(s) 6, 105, 177, 246
Eco130I CCWWGG 1 cut(s) 305
EcoRII CCWGG 1 cut(s) 427
EcoT14I CCWWGG 1 cut(s) 305
ErhI CCWWGG 1 cut(s) 305
FaiI YATR 1 cut(s) 505
FbaI TGATCA 1 cut(s) 64
GsuI CTGGAG 1 cut(s) 444
HaeIII GGCC 3 cut(s) 339, 405, 486
HapII CCGG 1 cut(s) 500
HincII GTYRAC 1 cut(s) 18
HindII GTYRAC 1 cut(s) 18
HpaII CCGG 1 cut(s) 500
HphI GGTGA 1 cut(s) 74
Hpy166II GTNNAC 1 cut(s) 18
Hpy188I TCNGA 1 cut(s) 468
Hpy188III TCNNGA 1 cut(s) 205
Hpy8I GTNNAC 1 cut(s) 18
HpyAV CCTTC 1 cut(s) 73
HpyCH4IV ACGT 1 cut(s) 436
HpyCH4V TGCA 2 cut(s) 4, 371
HpyF3I CTNAG 3 cut(s) 87, 159, 228
HpySE526I ACGT 1 cut(s) 436
Ksp22I TGATCA 1 cut(s) 64
Kzo9I GATC 1 cut(s) 64
LmnI GCTCC 1 cut(s) 463
MaeII ACGT 1 cut(s) 436
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MboII GAAGA 5 cut(s) 23, 122, 160, 194, 263
MluCI AATT 1 cut(s) 492
MnlI CCTC 5 cut(s) 99, 240, 306, 372, 460
MseI TTAA 3 cut(s) 294, 360, 474
MspI CCGG 1 cut(s) 500
MspR9I CCNGG 1 cut(s) 429
MvaI CCWGG 1 cut(s) 429
MvnI CGCG 1 cut(s) 180
NdeII GATC 1 cut(s) 64
NlaIV GGNNCC 1 cut(s) 447
Psp6I CCWGG 1 cut(s) 427
PspGI CCWGG 1 cut(s) 427
PspN4I GGNNCC 1 cut(s) 447
PspPI GGNCC 1 cut(s) 484
SaqAI TTAA 3 cut(s) 294, 360, 474
Sau3AI GATC 1 cut(s) 64
Sau96I GGNCC 1 cut(s) 484
ScrFI CCNGG 1 cut(s) 429
SetI ASST 6 cut(s) 84, 291, 357, 439, 460, 466
SfcI CTRYAG 1 cut(s) 453
Sse9I AATT 1 cut(s) 492
SsiI CCGC 2 cut(s) 103, 244
SspI AATATT 1 cut(s) 54
StyD4I CCNGG 1 cut(s) 427
StyI CCWWGG 1 cut(s) 305
TaiI ACGT 1 cut(s) 439
TaqII GACCGA 3 cut(s) 152, 224, 293
TasI AATT 1 cut(s) 492
Tru1I TTAA 3 cut(s) 294, 360, 474
Tru9I TTAA 3 cut(s) 294, 360, 474
TscAI CASTG 1 cut(s) 267
TspRI CASTG 1 cut(s) 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.