MD15G1022900.v1.1

disease resistance

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Reverse (-)
1334482 .. 1335182
701 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1022900.v1.1.491

Sequence Viewer

Length: 186 bp
ATGCTATTTGATGCTGTAAAATCAGTGCAGGAGGAGACTACAATGTTCAAGCACCTCCTCGGAGACATTAAATCTGCACTGGACTCTCTACAGCCACCCATCAAAGACATCGAAAAATATAACTCGAAAGAGGGACTGGAATATTTTGCAATACAAATAGAGGAGGGAGCAAATCTTGTTCAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

6.91

Weight (kDa)

4.57

Isoelectric Point (pI)

47.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 49, 182
Alw26I GTCTC 2 cut(s) 29, 57
BccI CCATC 1 cut(s) 107
BcoDI GTCTC 2 cut(s) 29, 57
BfmI CTRYAG 1 cut(s) 89
BsaJI CCNNGG 1 cut(s) 58
Bse1I ACTGG 2 cut(s) 84, 141
BseDI CCNNGG 1 cut(s) 58
BseNI ACTGG 2 cut(s) 84, 141
BseRI GAGGAG 3 cut(s) 47, 47, 176
BsgI GTGCAG 2 cut(s) 47, 60
BslFI GGGAC 1 cut(s) 147
BsmAI GTCTC 2 cut(s) 29, 57
BsmFI GGGAC 1 cut(s) 147
BsrI ACTGG 2 cut(s) 84, 141
BssECI CCNNGG 1 cut(s) 58
BstMAI GTCTC 2 cut(s) 29, 57
BstSFI CTRYAG 1 cut(s) 89
BtsIMutI CAGTG 2 cut(s) 30, 77
CviJI RGCY 1 cut(s) 94
CviKI_1 RGCY 1 cut(s) 94
FaiI YATR 1 cut(s) 120
FaqI GGGAC 1 cut(s) 147
HinfI GANTC 1 cut(s) 83
Hpy188I TCNGA 1 cut(s) 62
HpyCH4V TGCA 3 cut(s) 28, 77, 149
LmnI GCTCC 1 cut(s) 167
LpnPI CCDG 3 cut(s) 14, 65, 122
MlyI GAGTC 1 cut(s) 77
MnlI CCTC 6 cut(s) 25, 65, 68, 124, 154, 157
MseI TTAA 1 cut(s) 69
PleI GAGTC 1 cut(s) 77
PpsI GAGTC 1 cut(s) 77
SaqAI TTAA 1 cut(s) 69
SchI GAGTC 1 cut(s) 77
SetI ASST 1 cut(s) 57
SfcI CTRYAG 1 cut(s) 89
SgeI CNNG 6 cut(s) 41, 61, 71, 92, 136, 149
SspI AATATT 1 cut(s) 143
TaqI TCGA 2 cut(s) 111, 125
Tru1I TTAA 1 cut(s) 69
Tru9I TTAA 1 cut(s) 69
TscAI CASTG 2 cut(s) 30, 84
TspRI CASTG 2 cut(s) 30, 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.