Rh7CG338100
WRKY Family

WRKY Transcription Factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
37758500 .. 37758838
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG338100.1

Sequence Viewer

Length: 339 bp
ATGGCATCATTAGATGGAGGGACAGGGACTGCTCTAGGAGCAATATTGGGGATGCTACTTGAACTCGTTATAGAAGTGAAGGACAAGAATGTGATGTTTAAGCCTCTGCTCCAAGATCTCAAATCCACTTTAGAATCCTTAAAACCATTTGTCGAGGAAATGGCACAGCATAACAAGGTATTGCATCTCCCACAGGAGGAACTCAAGAGATTTGCAGTGGAAATGGAGAATGGAGTAAAGCTCGTTTGCAAGTGCTCTAAGGTTCGTTTGTTGGCAAGCTACAAAAAGTACGAATACACCAACAAACTTCTTGGATTGGATGAGTTTTGCCGGAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

12.69

Weight (kDa)

8.42

Isoelectric Point (pI)

35.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RPW8 PF05659 9 - 108 1.9e-28 Arabidopsis broad-spectrum mildew resistance protein RPW8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 290
AfiI CCNNNNNNNGG 1 cut(s) 196
AgsI TTSAA 1 cut(s) 62
AluBI AGCT 2 cut(s) 241, 279
AluI AGCT 2 cut(s) 241, 279
Alw21I GWGCWC 1 cut(s) 257
AlwNI CAGNNNCTG 1 cut(s) 29
Bbv12I GWGCWC 1 cut(s) 257
BccI CCATC 1 cut(s) 8
BfaI CTAG 1 cut(s) 35
BglII AGATCT 1 cut(s) 115
BmsI GCATC 3 cut(s) 14, 42, 193
BplI GAGNNNNNCTC 2 cut(s) 225, 257
BpuEI CTTGAG 1 cut(s) 188
Bsc4I CCNNNNNNNGG 1 cut(s) 196
BseGI GGATG 2 cut(s) 57, 325
BseLI CCNNNNNNNGG 1 cut(s) 196
BsiHKAI GWGCWC 1 cut(s) 257
BsiSI CCGG 1 cut(s) 331
BslFI GGGAC 2 cut(s) 34, 40
BslI CCNNNNNNNGG 1 cut(s) 196
BsmFI GGGAC 2 cut(s) 34, 40
Bsp1286I GDGCHC 1 cut(s) 257
Bsp143I GATC 1 cut(s) 115
BssMI GATC 1 cut(s) 115
BstC8I GCNNGC 1 cut(s) 277
BstDEI CTNAG 1 cut(s) 258
BstF5I GGATG 2 cut(s) 57, 325
BstKTI GATC 1 cut(s) 118
BstMBI GATC 1 cut(s) 115
BstMWI GCNNNNNNNGC 1 cut(s) 38
BstX2I RGATCY 1 cut(s) 115
BstYI RGATCY 1 cut(s) 115
BtsCI GGATG 2 cut(s) 57, 325
BtsI GCAGTG 1 cut(s) 222
BtsIMutI CAGTG 1 cut(s) 222
Cac8I GCNNGC 1 cut(s) 277
CaiI CAGNNNCTG 1 cut(s) 29
Csp6I GTAC 1 cut(s) 289
CviJI RGCY 3 cut(s) 103, 241, 279
CviKI_1 RGCY 3 cut(s) 103, 241, 279
CviQI GTAC 1 cut(s) 289
DdeI CTNAG 1 cut(s) 258
DpnI GATC 1 cut(s) 117
DpnII GATC 1 cut(s) 115
FaiI YATR 2 cut(s) 71, 171
FaqI GGGAC 2 cut(s) 34, 40
FokI GGATG 2 cut(s) 64, 332
FspBI CTAG 1 cut(s) 35
HapII CCGG 1 cut(s) 331
HinfI GANTC 1 cut(s) 134
HpaII CCGG 1 cut(s) 331
Hpy188III TCNNGA 1 cut(s) 205
HpyAV CCTTC 1 cut(s) 73
HpyCH4V TGCA 3 cut(s) 184, 215, 249
HpyF10VI GCNNNNNNNGC 1 cut(s) 38
HpyF3I CTNAG 1 cut(s) 258
Kzo9I GATC 1 cut(s) 115
LmnI GCTCC 2 cut(s) 38, 114
LpnPI CCDG 2 cut(s) 9, 179
LweI GCATC 3 cut(s) 14, 42, 193
MaeI CTAG 1 cut(s) 35
MalI GATC 1 cut(s) 117
MboI GATC 1 cut(s) 115
MflI RGATCY 1 cut(s) 115
MhlI GDGCHC 1 cut(s) 257
MnlI CCTC 4 cut(s) 11, 114, 148, 190
MseI TTAA 2 cut(s) 99, 140
MspI CCGG 1 cut(s) 331
MwoI GCNNNNNNNGC 1 cut(s) 38
NdeII GATC 1 cut(s) 115
PfeI GAWTC 1 cut(s) 134
PstNI CAGNNNCTG 1 cut(s) 29
PsuI RGATCY 1 cut(s) 115
RsaI GTAC 1 cut(s) 290
RsaNI GTAC 1 cut(s) 289
SaqAI TTAA 2 cut(s) 99, 140
Sau3AI GATC 1 cut(s) 115
SduI GDGCHC 1 cut(s) 257
SetI ASST 4 cut(s) 180, 243, 264, 281
SfaNI GCATC 3 cut(s) 14, 42, 193
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
SspI AATATT 1 cut(s) 45
SspMI CTAG 1 cut(s) 35
TaqI TCGA 1 cut(s) 153
TfiI GAWTC 1 cut(s) 134
Tru1I TTAA 2 cut(s) 99, 140
Tru9I TTAA 2 cut(s) 99, 140
TscAI CASTG 1 cut(s) 222
TspRI CASTG 1 cut(s) 222
XspI CTAG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.