Rmu_sc0002799.1_g000013
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002799.1
Physical Location & Seq
Forward (+)
85611 .. 86045
435 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002799.1_g000013.1.cds

Sequence Viewer

Length: 435 bp
atgctaattgatggaattgtagaattgatggaggagatgatcatgttcaaggtccatgtgagagatgtgaaatccacgctcgactgtttgaaaccagtgatccaggagataacggaatacaacgaggtgttgaagaatcaaccaatggaggaggaacaagcactgcagcacttgaaatcgcaaatagaagaaggcgcaattctggttcaaaagtgttccaaggttggtgcctggagtttccgcaaaaagtacaagtacagcaaccaactctttcaactcgatcaatcgcttcacacactcttgcaattgctcgaacagcagaaagcaagagatgtctgggagaccttggttacggtcaggaagatagagaccgtcgtccagcgaattgaaggaaacgtttgtgctatgcaaattagtcaatctgcaacctactag

Protein Analysis

144

Amino Acids

16.79

Weight (kDa)

5.66

Isoelectric Point (pI)

42.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 227
AciI CCGC 1 cut(s) 241
AclI AACGTT 1 cut(s) 396
AclWI GGATC 1 cut(s) 94
AfaI GTAC 2 cut(s) 251, 257
AgsI TTSAA 7 cut(s) 49, 91, 133, 175, 209, 275, 389
AjnI CCWGG 2 cut(s) 102, 230
Alw26I GTCTC 2 cut(s) 335, 362
AlwI GGATC 1 cut(s) 94
ApeKI GCWGC 1 cut(s) 166
AspLEI GCGC 1 cut(s) 197
AspS9I GGNCC 1 cut(s) 52
AvaII GGWCC 1 cut(s) 52
BanI GGYRCC 1 cut(s) 227
BbvI GCAGC 1 cut(s) 178
BccI CCATC 2 cut(s) 5, 22
BciT130I CCWGG 2 cut(s) 104, 232
BclI TGATCA 1 cut(s) 39
BcoDI GTCTC 2 cut(s) 335, 362
BfaI CTAG 1 cut(s) 433
BfmI CTRYAG 1 cut(s) 164
BisI GCNGC 1 cut(s) 167
BlsI GCNGC 1 cut(s) 168
Bme1390I CCNGG 2 cut(s) 104, 232
Bme18I GGWCC 1 cut(s) 52
BmgT120I GGNCC 1 cut(s) 52
BmiI GGNNCC 1 cut(s) 229
BmrFI CCNGG 2 cut(s) 104, 232
BoxI GACNNNNGTC 1 cut(s) 374
BpmI CTGGAG 1 cut(s) 253
BsaI GGTCTC 2 cut(s) 335, 362
BsaJI CCNNGG 2 cut(s) 219, 345
Bse1I ACTGG 1 cut(s) 95
BseBI CCWGG 2 cut(s) 104, 232
BseDI CCNNGG 2 cut(s) 219, 345
BseNI ACTGG 1 cut(s) 95
BseRI GAGGAG 2 cut(s) 47, 164
BseXI GCAGC 1 cut(s) 178
BshNI GGYRCC 1 cut(s) 227
BsmAI GTCTC 2 cut(s) 335, 362
Bso31I GGTCTC 2 cut(s) 335, 362
Bsp143I GATC 3 cut(s) 39, 99, 280
BspACI CCGC 1 cut(s) 241
BspLI GGNNCC 1 cut(s) 229
BspMAI CTGCAG 1 cut(s) 168
BspPI GGATC 1 cut(s) 94
BspT107I GGYRCC 1 cut(s) 227
BspTNI GGTCTC 2 cut(s) 335, 362
BsrI ACTGG 1 cut(s) 95
BssECI CCNNGG 2 cut(s) 219, 345
BssMI GATC 3 cut(s) 39, 99, 280
BssT1I CCWWGG 2 cut(s) 219, 345
Bst2UI CCWGG 2 cut(s) 104, 232
Bst4CI ACNGT 3 cut(s) 86, 355, 373
BstHHI GCGC 1 cut(s) 197
BstKTI GATC 3 cut(s) 42, 102, 283
BstMAI GTCTC 2 cut(s) 335, 362
BstMBI GATC 3 cut(s) 39, 99, 280
BstMWI GCNNNNNNNGC 1 cut(s) 316
BstNI CCWGG 2 cut(s) 104, 232
BstPAI GACNNNNGTC 1 cut(s) 374
BstSCI CCNGG 2 cut(s) 102, 230
BstSFI CTRYAG 1 cut(s) 164
BstV1I GCAGC 1 cut(s) 178
BtsI GCAGTG 1 cut(s) 161
BtsIMutI CAGTG 2 cut(s) 102, 161
CfoI GCGC 1 cut(s) 197
Cfr13I GGNCC 1 cut(s) 52
Csp6I GTAC 2 cut(s) 250, 256
CviAII CATG 2 cut(s) 43, 56
CviQI GTAC 2 cut(s) 250, 256
DpnI GATC 3 cut(s) 41, 101, 282
DpnII GATC 3 cut(s) 39, 99, 280
Eco130I CCWWGG 2 cut(s) 219, 345
Eco31I GGTCTC 2 cut(s) 335, 362
Eco47I GGWCC 1 cut(s) 52
EcoRII CCWGG 2 cut(s) 102, 230
EcoT14I CCWWGG 2 cut(s) 219, 345
ErhI CCWWGG 2 cut(s) 219, 345
FaeI CATG 2 cut(s) 46, 59
FaiI YATR 3 cut(s) 44, 57, 407
FatI CATG 2 cut(s) 42, 55
FbaI TGATCA 1 cut(s) 39
Fnu4HI GCNGC 1 cut(s) 167
Fsp4HI GCNGC 1 cut(s) 167
FspBI CTAG 1 cut(s) 433
GlaI GCGC 1 cut(s) 196
GluI GCNGC 1 cut(s) 167
GsuI CTGGAG 1 cut(s) 253
HhaI GCGC 1 cut(s) 197
Hin1II CATG 2 cut(s) 46, 59
Hin6I GCGC 1 cut(s) 195
HinP1I GCGC 1 cut(s) 195
HinfI GANTC 1 cut(s) 136
Hpy188III TCNNGA 1 cut(s) 358
Hpy99I CGWCG 1 cut(s) 377
HpyAV CCTTC 2 cut(s) 185, 383
HpyCH4III ACNGT 3 cut(s) 86, 355, 373
HpyCH4IV ACGT 1 cut(s) 396
HpyCH4V TGCA 4 cut(s) 166, 304, 409, 425
HpyF10VI GCNNNNNNNGC 1 cut(s) 316
HpySE526I ACGT 1 cut(s) 396
Hsp92II CATG 2 cut(s) 46, 59
HspAI GCGC 1 cut(s) 195
Ksp22I TGATCA 1 cut(s) 39
Kzo9I GATC 3 cut(s) 39, 99, 280
LpnPI CCDG 9 cut(s) 89, 108, 116, 188, 217, 244, 322, 343, 392
Lsp1109I GCAGC 1 cut(s) 178
MaeI CTAG 1 cut(s) 433
MaeII ACGT 1 cut(s) 396
MaeIII GTNAC 1 cut(s) 349
MalI GATC 3 cut(s) 41, 101, 282
MboI GATC 3 cut(s) 39, 99, 280
MboII GAAGA 3 cut(s) 145, 200, 373
MfeI CAATTG 1 cut(s) 305
MluCI AATT 7 cut(s) 6, 15, 23, 198, 305, 384, 411
MnlI CCTC 4 cut(s) 25, 118, 142, 145
MspR9I CCNGG 2 cut(s) 104, 232
MunI CAATTG 1 cut(s) 305
MvaI CCWGG 2 cut(s) 104, 232
MwoI GCNNNNNNNGC 1 cut(s) 316
NdeII GATC 3 cut(s) 39, 99, 280
NlaIII CATG 2 cut(s) 46, 59
NlaIV GGNNCC 1 cut(s) 229
PfeI GAWTC 1 cut(s) 136
PfoI TCCNGGA 1 cut(s) 102
PkrI GCNGC 1 cut(s) 168
PshAI GACNNNNGTC 1 cut(s) 374
Psp1406I AACGTT 1 cut(s) 396
Psp6I CCWGG 2 cut(s) 102, 230
PspGI CCWGG 2 cut(s) 102, 230
PspN4I GGNNCC 1 cut(s) 229
PspPI GGNCC 1 cut(s) 52
PstI CTGCAG 1 cut(s) 168
RsaI GTAC 2 cut(s) 251, 257
RsaNI GTAC 2 cut(s) 250, 256
SatI GCNGC 1 cut(s) 167
Sau3AI GATC 3 cut(s) 39, 99, 280
Sau96I GGNCC 1 cut(s) 52
ScrFI CCNGG 2 cut(s) 104, 232
SetI ASST 6 cut(s) 54, 129, 225, 347, 399, 431
SfcI CTRYAG 1 cut(s) 164
SinI GGWCC 1 cut(s) 52
Sse9I AATT 7 cut(s) 6, 15, 23, 198, 305, 384, 411
SsiI CCGC 1 cut(s) 241
SspMI CTAG 1 cut(s) 433
StyD4I CCNGG 2 cut(s) 102, 230
StyI CCWWGG 2 cut(s) 219, 345
TaaI ACNGT 3 cut(s) 86, 355, 373
TaiI ACGT 1 cut(s) 399
TaqI TCGA 3 cut(s) 81, 279, 312
TasI AATT 7 cut(s) 6, 15, 23, 198, 305, 384, 411
TatI WGTACW 2 cut(s) 249, 255
TfiI GAWTC 1 cut(s) 136
TscAI CASTG 2 cut(s) 102, 168
TseI GCWGC 1 cut(s) 166
TspGWI ACGGA 1 cut(s) 128
TspRI CASTG 2 cut(s) 102, 168
VpaK11BI GGWCC 1 cut(s) 52
XspI CTAG 1 cut(s) 433
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.