Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp02

Orthogroup ID

OG0000649

Physical Location & Seq

Genomic Coordinates Forward (+)

19642480 .. 19643279

Gene Structure 800 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.2G139100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 201 bp

ATGAGTTTGGAGGAGAAGTTCCAGATGTTGAGGAGCGTGGCAGAGGAATGTATTCAAGACTACGAGGTTCGGAATTTGCTGGCTCATAAGTCCGAACCCATCGCCTATGATGGGTTTGAACCCTCCGGTCGAATGCATATATTGCTCAGGTGTTTTTTCAAATTTTCTTTAACAATCATAAAATTCATAACGCATAATTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000166 GO:0003674 GO:0003824 GO:0004812 GO:0004831 GO:0005488 GO:0005515 GO:0005524 GO:0006082 GO:0006139 GO:0006399 GO:0006412 GO:0006418 GO:0006437 GO:0006518 GO:0006520 GO:0006725 GO:0006807 GO:0008144 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009987 GO:0010467 GO:0016070 GO:0016597 GO:0016874 GO:0016875 GO:0017076 GO:0019538 GO:0019752 GO:0030554 GO:0031406 GO:0032553 GO:0032555 GO:0032559 GO:0034641 GO:0034645 GO:0034660 GO:0035639 GO:0036094 GO:0042802 GO:0042803 GO:0043038 GO:0043039 GO:0043043 GO:0043167 GO:0043168 GO:0043169 GO:0043170 GO:0043177 GO:0043436 GO:0043603 GO:0043604 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044271 GO:0044281 GO:0046483 GO:0046983 GO:0071704 GO:0072545 GO:0090304 GO:0097159 GO:0097367 GO:0140098 GO:0140101 GO:1901265 GO:1901360 GO:1901363 GO:1901564 GO:1901566 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00970 map00970

Pfam Domains

Protein Families

tRNA-synt_1b

Protein Analysis

67

Amino Acids

7.82

Weight (kDa)

6.26

Isoelectric Point (pI)

85.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000649)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G33840
fragaria_vesca	FvH4_2g00190 FvH4_4g18133 FvH4_4g36450 FvH4_5g02490 FvH4_5g35150 FvH4_6g35840
malus_domestica	MD04G1034100.v1.1 MD06G1084100.v1.1
prunus_persica	Prupe.2G139100_v2.0.a1 Prupe.5G096900_v2.0.a1 Prupe.5G096900_v2.0.a1 Prupe.5G100500_v2.0.a1 Prupe.5G100500_v2.0.a1 Prupe.5G100500_v2.0.a1
pyrus_communis	pycom04g02850
rosa_chinensis	RchiOBHm_Chr1g0324941 RchiOBHm_Chr1g0340751 RchiOBHm_Chr2g0133721 RchiOBHm_Chr2g0153921 RchiOBHm_Chr4g0396761 RchiOBHm_Chr4g0414291 RchiOBHm_Chr4g0429871 RchiOBHm_Chr4g0446211 RchiOBHm_Chr5g0057181 RchiOBHm_Chr5g0057391 RchiOBHm_Chr5g0077561 RchiOBHm_Chr6g0307121 RchiOBHm_Chr7g0197611
rosa_laevigata	RLG00000003922 RLG00000005681 RLG00000017313 RLG00000029149 RLG00000035152
rosa_multiflora	Rmu_co8043936.1_g000001 Rmu_sc0001164.1_g000009 Rmu_sc0001334.1_g000004 Rmu_sc0004952.1_g000011 Rmu_sc0013154.1_g000007 Rmu_sc0017650.1_g000006 Rmu_sc0018062.1_g000003
rosa_roxburghii	Rroxscaffold_1G00023030 Rroxscaffold_2G00094650 Rroxscaffold_3G00223000 Rroxscaffold_3G00232150 Rroxscaffold_3G00248030 Rroxscaffold_3G00248040 Rroxscaffold_3G00258320
rosa_rugosa	Rorug04G0184600 Rorug04G0368500 Rorug05G0306000 Rorug05G0307100 Rorug07G0041900
rosa_samantha	Rh2CG164400 Rh2DG389300 Rh3AG306800 Rh4AG430600 Rh4BG440000 Rh4CG457300 Rh4DG438500 Rh5AG375500 Rh5BG386300 Rh5CG409700 Rh5DG400300 Rh6CG481100 Rh7AG166300 Rh7AG360600 Rh7BG168400 Rh7CG174700 Rh7DG168000 Rh7DG387600
rosa_wichuraiana	Rw2G022790 Rw4G036780 Rw5G035320 Rw5G035460 Rw7G014480 Rw7G038030

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	3 cut(s)	73, 161, 182
AfiI	CCNNNNNNNGG	1 cut(s)	111
AgsI	TTSAA	3 cut(s)	56, 119, 160
AloI	GAACNNNNNNTCC	1 cut(s)	34
ApoI	RAATTY	3 cut(s)	73, 161, 182
Asp700I	GAANNNNTTC	1 cut(s)	51
BccI	CCATC	2 cut(s)	104, 107
Bpu10I	CCTNAGC	1 cut(s)	146
BsaWI	WCCGGW	1 cut(s)	125
BsaXI	ACNNNNNCTCC	1 cut(s)	32
Bsc4I	CCNNNNNNNGG	1 cut(s)	111
BseLI	CCNNNNNNNGG	1 cut(s)	111
BseMII	CTCAG	1 cut(s)	160
BseRI	GAGGAG	2 cut(s)	26, 46
Bsh1285I	CGRYCG	1 cut(s)	130
BsiEI	CGRYCG	1 cut(s)	130
BsiSI	CCGG	1 cut(s)	126
BslI	CCNNNNNNNGG	1 cut(s)	111
BsmI	GAATGC	1 cut(s)	138
BspCNI	CTCAG	1 cut(s)	159
BstAPI	GCANNNNNTGC	1 cut(s)	142
BstC8I	GCNNGC	1 cut(s)	81
BstDEI	CTNAG	1 cut(s)	146
BstMCI	CGRYCG	1 cut(s)	130
BstMWI	GCNNNNNNNGC	1 cut(s)	142
BtgZI	GCGATG	1 cut(s)	85
Cac8I	GCNNGC	1 cut(s)	81
CviJI	RGCY	1 cut(s)	83
CviKI_1	RGCY	1 cut(s)	83
DdeI	CTNAG	1 cut(s)	146
EcoT22I	ATGCAT	1 cut(s)	138
FaiI	YATR	7 cut(s)	87, 108, 138, 140, 179, 188, 195
HapII	CCGG	1 cut(s)	126
HpaII	CCGG	1 cut(s)	126
Hpy188I	TCNGA	2 cut(s)	72, 94
Hpy188III	TCNNGA	2 cut(s)	22, 56
HpyCH4V	TGCA	1 cut(s)	136
HpyF10VI	GCNNNNNNNGC	1 cut(s)	142
HpyF3I	CTNAG	1 cut(s)	146
LmnI	GCTCC	1 cut(s)	33
LpnPI	CCDG	4 cut(s)	35, 65, 133, 139
MluCI	AATT	4 cut(s)	73, 161, 182, 196
MnlI	CCTC	5 cut(s)	4, 24, 37, 58, 133
Mph1103I	ATGCAT	1 cut(s)	138
MroXI	GAANNNNTTC	1 cut(s)	51
MseI	TTAA	1 cut(s)	170
MspI	CCGG	1 cut(s)	126
Mva1269I	GAATGC	1 cut(s)	138
MwoI	GCNNNNNNNGC	1 cut(s)	142
NsiI	ATGCAT	1 cut(s)	138
PctI	GAATGC	1 cut(s)	138
PdmI	GAANNNNTTC	1 cut(s)	51
SaqAI	TTAA	1 cut(s)	170
SetI	ASST	2 cut(s)	69, 152
SgeI	CNNG	7 cut(s)	34, 49, 68, 76, 92, 138, 160
Sse9I	AATT	4 cut(s)	73, 161, 182, 196
TaqI	TCGA	1 cut(s)	130
TasI	AATT	4 cut(s)	73, 161, 182, 196
Tru1I	TTAA	1 cut(s)	170
Tru9I	TTAA	1 cut(s)	170
TspDTI	ATGAA	1 cut(s)	175
XapI	RAATTY	3 cut(s)	73, 161, 182
XmnI	GAANNNNTTC	1 cut(s)	51
Zsp2I	ATGCAT	1 cut(s)	138

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.