Rorug04G0184600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0000649
Physical Location & Seq
Forward (+)
32163588 .. 32163830
243 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0184600.1

Sequence Viewer

Length: 243 bp
ATGACCTGGTTGGAAGAGTTTCAAAAGGCCAGGAAATCAGAAACTCATCAAACAAAGCAAGCAATAAGACAAGTTTGGAAACCTGCTTATGATAATGATTTAAAACTCAATGTTGAAGGTGCTTATGTACAGCAGCTACCAAAAGGAGGACTTGGAGGCATTCTCAGAAACTCTGATGGGATAGTAGTTCCTGCTTTTGCTAAATCAGTACAATTAACATGCGAGTTCTGCACATCATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

8.97

Weight (kDa)

8.52

Isoelectric Point (pI)

44.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000649)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G33840
fragaria_vesca FvH4_2g00190 FvH4_4g18133 FvH4_4g36450 FvH4_5g02490 FvH4_5g35150 FvH4_6g35840
malus_domestica MD04G1034100.v1.1 MD06G1084100.v1.1
prunus_persica Prupe.2G139100_v2.0.a1 Prupe.5G096900_v2.0.a1 Prupe.5G096900_v2.0.a1 Prupe.5G100500_v2.0.a1 Prupe.5G100500_v2.0.a1 Prupe.5G100500_v2.0.a1
pyrus_communis pycom04g02850
rosa_chinensis RchiOBHm_Chr1g0324941 RchiOBHm_Chr1g0340751 RchiOBHm_Chr2g0133721 RchiOBHm_Chr2g0153921 RchiOBHm_Chr4g0396761 RchiOBHm_Chr4g0414291 RchiOBHm_Chr4g0429871 RchiOBHm_Chr4g0446211 RchiOBHm_Chr5g0057181 RchiOBHm_Chr5g0057391 RchiOBHm_Chr5g0077561 RchiOBHm_Chr6g0307121 RchiOBHm_Chr7g0197611
rosa_laevigata RLG00000003922 RLG00000005681 RLG00000017313 RLG00000029149 RLG00000035152
rosa_multiflora Rmu_co8043936.1_g000001 Rmu_sc0001164.1_g000009 Rmu_sc0001334.1_g000004 Rmu_sc0004952.1_g000011 Rmu_sc0013154.1_g000007 Rmu_sc0017650.1_g000006 Rmu_sc0018062.1_g000003
rosa_roxburghii Rroxscaffold_1G00023030 Rroxscaffold_2G00094650 Rroxscaffold_3G00223000 Rroxscaffold_3G00232150 Rroxscaffold_3G00248030 Rroxscaffold_3G00248040 Rroxscaffold_3G00258320
rosa_rugosa Rorug04G0184600 Rorug04G0368500 Rorug05G0306000 Rorug05G0307100 Rorug07G0041900
rosa_samantha Rh2CG164400 Rh2DG389300 Rh3AG306800 Rh4AG430600 Rh4BG440000 Rh4CG457300 Rh4DG438500 Rh5AG375500 Rh5BG386300 Rh5CG409700 Rh5DG400300 Rh6CG481100 Rh7AG166300 Rh7AG360600 Rh7BG168400 Rh7CG174700 Rh7DG168000 Rh7DG387600
rosa_wichuraiana Rw2G022790 Rw4G036780 Rw5G035320 Rw5G035460 Rw7G014480 Rw7G038030

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 91
AfaI GTAC 2 cut(s) 129, 210
AfiI CCNNNNNNNGG 1 cut(s) 146
AgsI TTSAA 2 cut(s) 23, 116
AjnI CCWGG 2 cut(s) 5, 29
AluBI AGCT 1 cut(s) 136
AluI AGCT 1 cut(s) 136
AoxI GGCC 1 cut(s) 27
ApeKI GCWGC 1 cut(s) 133
Asp700I GAANNNNTTC 1 cut(s) 18
BbvI GCAGC 1 cut(s) 145
BccI CCATC 1 cut(s) 170
BciT130I CCWGG 2 cut(s) 7, 31
BfuAI ACCTGC 1 cut(s) 91
BisI GCNGC 1 cut(s) 134
BlsI GCNGC 1 cut(s) 135
Bme1390I CCNGG 2 cut(s) 7, 31
BmrFI CCNGG 2 cut(s) 7, 31
BplI GAGNNNNNCTC 2 cut(s) 147, 179
Bsc4I CCNNNNNNNGG 1 cut(s) 146
BseBI CCWGG 2 cut(s) 7, 31
BseLI CCNNNNNNNGG 1 cut(s) 146
BseMII CTCAG 1 cut(s) 178
BseXI GCAGC 1 cut(s) 145
BsgI GTGCAG 1 cut(s) 214
BshFI GGCC 1 cut(s) 29
BslI CCNNNNNNNGG 1 cut(s) 146
BsmI GAATGC 1 cut(s) 159
BsnI GGCC 1 cut(s) 29
Bsp1407I TGTACA 1 cut(s) 127
BspANI GGCC 1 cut(s) 29
BspCNI CTCAG 1 cut(s) 177
BspMI ACCTGC 1 cut(s) 91
BsrGI TGTACA 1 cut(s) 127
Bst2UI CCWGG 2 cut(s) 7, 31
Bst6I CTCTTC 1 cut(s) 9
BstAUI TGTACA 1 cut(s) 127
BstC8I GCNNGC 1 cut(s) 60
BstDEI CTNAG 1 cut(s) 164
BstMWI GCNNNNNNNGC 1 cut(s) 228
BstNI CCWGG 2 cut(s) 7, 31
BstNSI RCATGY 1 cut(s) 222
BstSCI CCNGG 2 cut(s) 5, 29
BstV1I GCAGC 1 cut(s) 145
BsuRI GGCC 1 cut(s) 29
BveI ACCTGC 1 cut(s) 91
Cac8I GCNNGC 1 cut(s) 60
CsiI ACCWGGT 1 cut(s) 5
Csp6I GTAC 2 cut(s) 128, 209
CviAII CATG 2 cut(s) 219, 237
CviJI RGCY 2 cut(s) 29, 136
CviKI_1 RGCY 2 cut(s) 29, 136
CviQI GTAC 2 cut(s) 128, 209
DdeI CTNAG 1 cut(s) 164
DraI TTTAAA 1 cut(s) 102
Eam1104I CTCTTC 1 cut(s) 9
EarI CTCTTC 1 cut(s) 9
EcoRII CCWGG 2 cut(s) 5, 29
FaeI CATG 2 cut(s) 222, 240
FaiI YATR 4 cut(s) 90, 126, 220, 238
FalI AAGNNNNNCTT 2 cut(s) 135, 167
FatI CATG 2 cut(s) 218, 236
Fnu4HI GCNGC 1 cut(s) 134
Fsp4HI GCNGC 1 cut(s) 134
GluI GCNGC 1 cut(s) 134
HaeIII GGCC 1 cut(s) 29
Hin1II CATG 2 cut(s) 222, 240
Hpy188I TCNGA 3 cut(s) 40, 167, 175
HpyAV CCTTC 1 cut(s) 110
HpyCH4V TGCA 1 cut(s) 231
HpyF10VI GCNNNNNNNGC 1 cut(s) 228
HpyF3I CTNAG 1 cut(s) 164
Hsp92II CATG 2 cut(s) 222, 240
LpnPI CCDG 5 cut(s) 16, 19, 43, 96, 204
Lsp1109I GCAGC 1 cut(s) 145
MabI ACCWGGT 1 cut(s) 5
MboII GAAGA 1 cut(s) 26
MluCI AATT 1 cut(s) 212
MnlI CCTC 2 cut(s) 140, 149
MroXI GAANNNNTTC 1 cut(s) 18
MseI TTAA 2 cut(s) 101, 215
MspR9I CCNGG 2 cut(s) 7, 31
Mva1269I GAATGC 1 cut(s) 159
MvaI CCWGG 2 cut(s) 7, 31
MwoI GCNNNNNNNGC 1 cut(s) 228
NlaIII CATG 2 cut(s) 222, 240
NspI RCATGY 1 cut(s) 222
PctI GAATGC 1 cut(s) 159
PdmI GAANNNNTTC 1 cut(s) 18
PkrI GCNGC 1 cut(s) 135
Psp6I CCWGG 2 cut(s) 5, 29
PspGI CCWGG 2 cut(s) 5, 29
RsaI GTAC 2 cut(s) 129, 210
RsaNI GTAC 2 cut(s) 128, 209
SaqAI TTAA 2 cut(s) 101, 215
SatI GCNGC 1 cut(s) 134
ScrFI CCNGG 2 cut(s) 7, 31
SetI ASST 4 cut(s) 8, 85, 121, 138
SexAI ACCWGGT 1 cut(s) 5
Sse9I AATT 1 cut(s) 212
StyD4I CCNGG 2 cut(s) 5, 29
TasI AATT 1 cut(s) 212
TatI WGTACW 2 cut(s) 127, 208
Tru1I TTAA 2 cut(s) 101, 215
Tru9I TTAA 2 cut(s) 101, 215
TseI GCWGC 1 cut(s) 133
XceI RCATGY 1 cut(s) 222
XmnI GAANNNNTTC 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.