pycom15g05360

Short calmodulin-binding motif containing conserved Ile and Gln residues.

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
3202036 .. 3202382
347 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 249 bp
ATGCTTGTTAGCACAGATGGAGGGTCAAAGTGGATTTTTGTTTTCAGCCCATCAGGAAGCACATACGTGGGGAAGAAAAAGAAAGGTATTTTTAACCACTCAAGTTTTCTATCCGGAGGGGCTGTAATAACAGCTGGAAGATTAGTTGCCCACAACGGGGTTCTTGAGGCTATATGGCCACACACTACTTGCTATCGCCCGTCTGAAGATAGTAAAGAATTCCTTAGCTTCTTGAGGGACACCAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

8.95

Weight (kDa)

9.52

Isoelectric Point (pI)

27.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 113
AcoI YGGCCR 1 cut(s) 176
AcsI RAATTY 1 cut(s) 218
AcuI CTGAAG 1 cut(s) 225
AfiI CCNNNNNNNGG 2 cut(s) 156, 157
AleI CACNNNNGTG 1 cut(s) 65
AluBI AGCT 2 cut(s) 134, 228
AluI AGCT 2 cut(s) 134, 228
Aor13HI TCCGGA 1 cut(s) 113
AoxI GGCC 1 cut(s) 176
ApoI RAATTY 1 cut(s) 218
BalI TGGCCA 1 cut(s) 178
BccI CCATC 2 cut(s) 11, 58
Bpu10I CCTNAGC 1 cut(s) 224
BpuEI CTTGAG 2 cut(s) 85, 185
BsaAI YACGTR 1 cut(s) 67
BsaWI WCCGGW 1 cut(s) 113
BsaXI ACNNNNNCTCC 2 cut(s) 108, 138
Bsc4I CCNNNNNNNGG 2 cut(s) 156, 157
BseAI TCCGGA 1 cut(s) 113
BseLI CCNNNNNNNGG 2 cut(s) 156, 157
BshFI GGCC 1 cut(s) 178
BsiSI CCGG 1 cut(s) 114
BslI CCNNNNNNNGG 2 cut(s) 156, 157
BsnI GGCC 1 cut(s) 178
Bsp13I TCCGGA 1 cut(s) 113
BspANI GGCC 1 cut(s) 178
BspEI TCCGGA 1 cut(s) 113
BstBAI YACGTR 1 cut(s) 67
BstDEI CTNAG 1 cut(s) 224
BsuRI GGCC 1 cut(s) 178
CviJI RGCY 6 cut(s) 48, 122, 134, 170, 178, 228
CviKI_1 RGCY 6 cut(s) 48, 122, 134, 170, 178, 228
DdeI CTNAG 1 cut(s) 224
EaeI YGGCCR 1 cut(s) 176
Eco57I CTGAAG 1 cut(s) 225
EcoRI GAATTC 1 cut(s) 218
FaiI YATR 3 cut(s) 64, 173, 175
FalI AAGNNNNNCTT 2 cut(s) 207, 239
HaeIII GGCC 1 cut(s) 178
HapII CCGG 1 cut(s) 114
HpaII CCGG 1 cut(s) 114
Hpy188I TCNGA 1 cut(s) 205
Hpy188III TCNNGA 4 cut(s) 54, 114, 164, 232
HpyCH4IV ACGT 1 cut(s) 66
HpyF3I CTNAG 1 cut(s) 224
HpySE526I ACGT 1 cut(s) 66
Kpn2I TCCGGA 1 cut(s) 113
LpnPI CCDG 3 cut(s) 39, 120, 127
MaeII ACGT 1 cut(s) 66
MboII GAAGA 3 cut(s) 85, 150, 218
MlsI TGGCCA 1 cut(s) 178
MluCI AATT 1 cut(s) 218
MluNI TGGCCA 1 cut(s) 178
MnlI CCTC 4 cut(s) 14, 110, 160, 228
Mox20I TGGCCA 1 cut(s) 178
MroI TCCGGA 1 cut(s) 113
MscI TGGCCA 1 cut(s) 178
MseI TTAA 1 cut(s) 93
MslI CAYNNNNRTG 1 cut(s) 65
Msp20I TGGCCA 1 cut(s) 178
MspA1I CMGCKG 1 cut(s) 134
MspI CCGG 1 cut(s) 114
OliI CACNNNNGTG 1 cut(s) 65
Ppu21I YACGTR 1 cut(s) 67
PvuII CAGCTG 1 cut(s) 134
RseI CAYNNNNRTG 1 cut(s) 65
SaqAI TTAA 1 cut(s) 93
SetI ASST 4 cut(s) 69, 88, 136, 230
SmiMI CAYNNNNRTG 1 cut(s) 65
SmlI CTYRAG 3 cut(s) 100, 164, 232
SmoI CTYRAG 3 cut(s) 100, 164, 232
Sse9I AATT 1 cut(s) 218
TaiI ACGT 1 cut(s) 69
TasI AATT 1 cut(s) 218
Tru1I TTAA 1 cut(s) 93
Tru9I TTAA 1 cut(s) 93
XapI RAATTY 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.