Rorug02G0390500

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
49923755 .. 49924156
402 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0390500.1

Sequence Viewer

Length: 222 bp
ATGGTGGCCTTTGAAATTGTTTTGCAAGAACTTCATATAAGAAAGAAGCAATGGAAGGTGCAGCACCAAATCAAAAGATGTTATGCTGTGATCACGTCCGAAAACGCAAGGAGGAGAAAGGCTTCTTCTCTGCTTGTTTGTTTGCTTTGTTCTGCTGCTGTTGCTGCTATGGTGGCTGCTGCTGTGGCCCTTAGATTTCTTGCCATTGAGTGGGATCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.3

Weight (kDa)

9.81

Isoelectric Point (pI)

63.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 210
AfiI CCNNNNNNNGG 1 cut(s) 210
AgsI TTSAA 1 cut(s) 14
AjiI CACGTC 1 cut(s) 96
AoxI GGCC 2 cut(s) 6, 186
ApeKI GCWGC 5 cut(s) 61, 155, 164, 176, 179
Asp700I GAANNNNTTC 1 cut(s) 121
AspS9I GGNCC 1 cut(s) 187
BbvI GCAGC 5 cut(s) 73, 142, 151, 163, 166
BclI TGATCA 1 cut(s) 90
BisI GCNGC 5 cut(s) 62, 156, 165, 177, 180
BlsI GCNGC 5 cut(s) 63, 157, 166, 178, 181
BmgBI CACGTC 1 cut(s) 96
BmgT120I GGNCC 1 cut(s) 187
Bsc4I CCNNNNNNNGG 1 cut(s) 210
Bse3DI GCAATG 1 cut(s) 56
BseLI CCNNNNNNNGG 1 cut(s) 210
BseMI GCAATG 1 cut(s) 56
BseRI GAGGAG 1 cut(s) 127
BseXI GCAGC 5 cut(s) 73, 142, 151, 163, 166
BsgI GTGCAG 1 cut(s) 80
BshFI GGCC 2 cut(s) 8, 188
BslI CCNNNNNNNGG 1 cut(s) 210
BsnI GGCC 2 cut(s) 8, 188
Bsp143I GATC 2 cut(s) 90, 214
BspANI GGCC 2 cut(s) 8, 188
BsrDI GCAATG 1 cut(s) 56
BssMI GATC 2 cut(s) 90, 214
BstDEI CTNAG 1 cut(s) 191
BstKTI GATC 2 cut(s) 93, 217
BstMBI GATC 2 cut(s) 90, 214
BstMWI GCNNNNNNNGC 4 cut(s) 161, 164, 173, 185
BstV1I GCAGC 5 cut(s) 73, 142, 151, 163, 166
BsuRI GGCC 2 cut(s) 8, 188
BtrI CACGTC 1 cut(s) 96
Cfr13I GGNCC 1 cut(s) 187
CviJI RGCY 4 cut(s) 8, 122, 176, 188
CviKI_1 RGCY 4 cut(s) 8, 122, 176, 188
DdeI CTNAG 1 cut(s) 191
DpnI GATC 2 cut(s) 92, 216
DpnII GATC 2 cut(s) 90, 214
FaiI YATR 4 cut(s) 36, 38, 84, 170
FbaI TGATCA 1 cut(s) 90
Fnu4HI GCNGC 5 cut(s) 62, 156, 165, 177, 180
Fsp4HI GCNGC 5 cut(s) 62, 156, 165, 177, 180
GluI GCNGC 5 cut(s) 62, 156, 165, 177, 180
HaeIII GGCC 2 cut(s) 8, 188
Hpy188I TCNGA 1 cut(s) 100
HpyAV CCTTC 1 cut(s) 49
HpyCH4IV ACGT 1 cut(s) 95
HpyCH4V TGCA 2 cut(s) 25, 61
HpyF10VI GCNNNNNNNGC 4 cut(s) 161, 164, 173, 185
HpyF3I CTNAG 1 cut(s) 191
HpySE526I ACGT 1 cut(s) 95
Ksp22I TGATCA 1 cut(s) 90
Kzo9I GATC 2 cut(s) 90, 214
Lsp1109I GCAGC 5 cut(s) 73, 142, 151, 163, 166
MaeII ACGT 1 cut(s) 95
MalI GATC 2 cut(s) 92, 216
MboI GATC 2 cut(s) 90, 214
MboII GAAGA 1 cut(s) 117
MluCI AATT 1 cut(s) 15
MnlI CCTC 1 cut(s) 105
MroXI GAANNNNTTC 1 cut(s) 121
MwoI GCNNNNNNNGC 4 cut(s) 161, 164, 173, 185
NdeII GATC 2 cut(s) 90, 214
PdmI GAANNNNTTC 1 cut(s) 121
PflMI CCANNNNNTGG 1 cut(s) 210
PkrI GCNGC 5 cut(s) 63, 157, 166, 178, 181
PspPI GGNCC 1 cut(s) 187
SatI GCNGC 5 cut(s) 62, 156, 165, 177, 180
Sau3AI GATC 2 cut(s) 90, 214
Sau96I GGNCC 1 cut(s) 187
SetI ASST 2 cut(s) 60, 98
SgeI CNNG 5 cut(s) 38, 106, 120, 146, 212
Sse9I AATT 1 cut(s) 15
TaiI ACGT 1 cut(s) 98
TasI AATT 1 cut(s) 15
TseI GCWGC 5 cut(s) 61, 155, 164, 176, 179
TspDTI ATGAA 1 cut(s) 23
Van91I CCANNNNNTGG 1 cut(s) 210
XmnI GAANNNNTTC 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.