RchiOBHm_Chr3g0459431

Short calmodulin-binding motif containing conserved Ile and Gln residues.

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0000760
Physical Location & Seq
Reverse (-)
7870289 .. 7870656
368 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ42602

Sequence Viewer

Length: 270 bp
ATGATTCAGAAAGAAAGGAAATCCCATGAAGTATTAGTGGAAAATGGCAAGCTAATGTATAAGCAAAGTGGGATGCTTGTGAATAGTAGTGAAGGTTCGAAATCGATATTCGTGCTAAGCACAACAAGGGCTTTGTATGTTGGTCAAAAGAAGGGTCAGTTTGACCATTTGAGTTTTCTATCTGGAGGTGCTACCACAGCAGCTGGAAGATTGGTTGCCCATGATGGGGTTCTTGAGGCCATTTGGCCATACAGTGATCATTACGGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

9.76

Weight (kDa)

9.01

Isoelectric Point (pI)

22.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 245
AfiI CCNNNNNNNGG 2 cut(s) 225, 226
AluBI AGCT 2 cut(s) 52, 203
AluI AGCT 2 cut(s) 52, 203
AlwNI CAGNNNCTG 1 cut(s) 203
AoxI GGCC 2 cut(s) 237, 245
ApeKI GCWGC 1 cut(s) 200
ArsI GACNNNNNNTTYG 2 cut(s) 139, 171
AsuII TTCGAA 1 cut(s) 98
BalI TGGCCA 1 cut(s) 247
BbvI GCAGC 1 cut(s) 212
BccI CCATC 1 cut(s) 218
BcgI CGANNNNNNTGC 2 cut(s) 94, 128
BclI TGATCA 1 cut(s) 256
BisI GCNGC 1 cut(s) 201
BlpI GCTNAGC 1 cut(s) 116
BlsI GCNGC 1 cut(s) 202
BmsI GCATC 1 cut(s) 63
BpmI CTGGAG 1 cut(s) 204
Bpu1102I GCTNAGC 1 cut(s) 116
Bpu14I TTCGAA 1 cut(s) 98
BpuEI CTTGAG 1 cut(s) 254
Bsa29I ATCGAT 1 cut(s) 104
Bsc4I CCNNNNNNNGG 2 cut(s) 225, 226
BseCI ATCGAT 1 cut(s) 104
BseGI GGATG 1 cut(s) 78
BseLI CCNNNNNNNGG 2 cut(s) 225, 226
BseXI GCAGC 1 cut(s) 212
BshFI GGCC 2 cut(s) 239, 247
BshVI ATCGAT 1 cut(s) 104
BslI CCNNNNNNNGG 2 cut(s) 225, 226
BsnI GGCC 2 cut(s) 239, 247
Bsp119I TTCGAA 1 cut(s) 98
Bsp143I GATC 1 cut(s) 256
Bsp1720I GCTNAGC 1 cut(s) 116
BspANI GGCC 2 cut(s) 239, 247
BspDI ATCGAT 1 cut(s) 104
BspT104I TTCGAA 1 cut(s) 98
BssMI GATC 1 cut(s) 256
Bst4CI ACNGT 1 cut(s) 254
BstBI TTCGAA 1 cut(s) 98
BstC8I GCNNGC 1 cut(s) 50
BstDEI CTNAG 1 cut(s) 116
BstF5I GGATG 1 cut(s) 78
BstKTI GATC 1 cut(s) 259
BstMBI GATC 1 cut(s) 256
BstMWI GCNNNNNNNGC 1 cut(s) 197
BstV1I GCAGC 1 cut(s) 212
Bsu15I ATCGAT 1 cut(s) 104
BsuRI GGCC 2 cut(s) 239, 247
BsuTUI ATCGAT 1 cut(s) 104
BtsCI GGATG 1 cut(s) 78
BtsIMutI CAGTG 1 cut(s) 259
Cac8I GCNNGC 1 cut(s) 50
CaiI CAGNNNCTG 1 cut(s) 203
ClaI ATCGAT 1 cut(s) 104
CviAII CATG 2 cut(s) 26, 221
CviJI RGCY 5 cut(s) 52, 131, 203, 239, 247
CviKI_1 RGCY 5 cut(s) 52, 131, 203, 239, 247
DdeI CTNAG 1 cut(s) 116
DpnI GATC 1 cut(s) 258
DpnII GATC 1 cut(s) 256
EaeI YGGCCR 1 cut(s) 245
FaeI CATG 2 cut(s) 29, 224
FaiI YATR 5 cut(s) 27, 60, 138, 222, 250
FatI CATG 2 cut(s) 25, 220
FbaI TGATCA 1 cut(s) 256
Fnu4HI GCNGC 1 cut(s) 201
FokI GGATG 1 cut(s) 85
Fsp4HI GCNGC 1 cut(s) 201
GluI GCNGC 1 cut(s) 201
GsuI CTGGAG 1 cut(s) 204
HaeIII GGCC 2 cut(s) 239, 247
Hin1II CATG 2 cut(s) 29, 224
HinfI GANTC 1 cut(s) 4
Hpy188I TCNGA 1 cut(s) 9
Hpy188III TCNNGA 2 cut(s) 183, 233
HpyAV CCTTC 2 cut(s) 86, 145
HpyCH4III ACNGT 1 cut(s) 254
HpyF10VI GCNNNNNNNGC 1 cut(s) 197
HpyF3I CTNAG 1 cut(s) 116
Hsp92II CATG 2 cut(s) 29, 224
Ksp22I TGATCA 1 cut(s) 256
Kzo9I GATC 1 cut(s) 256
LpnPI CCDG 2 cut(s) 168, 189
Lsp1109I GCAGC 1 cut(s) 212
LweI GCATC 1 cut(s) 63
MalI GATC 1 cut(s) 258
MboI GATC 1 cut(s) 256
MboII GAAGA 1 cut(s) 219
MlsI TGGCCA 1 cut(s) 247
MluNI TGGCCA 1 cut(s) 247
MnlI CCTC 2 cut(s) 179, 229
Mox20I TGGCCA 1 cut(s) 247
MscI TGGCCA 1 cut(s) 247
Msp20I TGGCCA 1 cut(s) 247
MspA1I CMGCKG 1 cut(s) 203
MwoI GCNNNNNNNGC 1 cut(s) 197
NdeII GATC 1 cut(s) 256
NlaIII CATG 2 cut(s) 29, 224
NspV TTCGAA 1 cut(s) 98
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 1 cut(s) 202
PsrI GAACNNNNNNTAC 2 cut(s) 79, 111
PstNI CAGNNNCTG 1 cut(s) 203
PvuII CAGCTG 1 cut(s) 203
SatI GCNGC 1 cut(s) 201
Sau3AI GATC 1 cut(s) 256
SetI ASST 4 cut(s) 54, 97, 190, 205
SfaNI GCATC 1 cut(s) 63
SfuI TTCGAA 1 cut(s) 98
SgeI CNNG 9 cut(s) 38, 61, 89, 124, 138, 195, 216, 233, 245
SmlI CTYRAG 1 cut(s) 233
SmoI CTYRAG 1 cut(s) 233
TaaI ACNGT 1 cut(s) 254
TaqI TCGA 2 cut(s) 98, 104
TfiI GAWTC 1 cut(s) 4
TscAI CASTG 1 cut(s) 259
TseI GCWGC 1 cut(s) 200
TspDTI ATGAA 1 cut(s) 42
TspRI CASTG 1 cut(s) 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.