Rmu_sc0021645.1_g000001

Short calmodulin-binding motif containing conserved Ile and Gln residues.

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021645.1
Physical Location & Seq
Reverse (-)
1 .. 499
499 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021645.1_g000001.1.cds

Sequence Viewer

Length: 150 bp
atgtcggctgttgctctgtctcaaccggattttatgtttttgccgagaccggttaaggagcttaatgatgcagcagtcaaagttcagaaggtttacaagagttatagaactcgaagaaaccttgcagattgtgcagtggtggctgaggag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.66

Weight (kDa)

8.98

Isoelectric Point (pI)

42.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgeI ACCGGT 1 cut(s) 49
AluBI AGCT 1 cut(s) 61
AluI AGCT 1 cut(s) 61
Alw26I GTCTC 2 cut(s) 24, 40
ApeKI GCWGC 1 cut(s) 71
AsiGI ACCGGT 1 cut(s) 49
BbvCI CCTCAGC 1 cut(s) 144
BbvI GCAGC 1 cut(s) 83
BcoDI GTCTC 2 cut(s) 24, 40
BisI GCNGC 1 cut(s) 72
BlsI GCNGC 1 cut(s) 73
BmsI GCATC 1 cut(s) 58
Bpu10I CCTNAGC 1 cut(s) 144
BsaI GGTCTC 1 cut(s) 40
BsaWI WCCGGW 2 cut(s) 25, 49
Bse118I RCCGGY 1 cut(s) 49
BseMII CTCAG 1 cut(s) 135
BseXI GCAGC 1 cut(s) 83
BshTI ACCGGT 1 cut(s) 49
BsiSI CCGG 2 cut(s) 26, 50
BsmAI GTCTC 2 cut(s) 24, 40
Bso31I GGTCTC 1 cut(s) 40
BspCNI CTCAG 1 cut(s) 136
BspTNI GGTCTC 1 cut(s) 40
BsrFI RCCGGY 1 cut(s) 49
BssAI RCCGGY 1 cut(s) 49
BstAPI GCANNNNNTGC 1 cut(s) 131
BstDEI CTNAG 1 cut(s) 144
BstMAI GTCTC 2 cut(s) 24, 40
BstMWI GCNNNNNNNGC 2 cut(s) 131, 140
BstV1I GCAGC 1 cut(s) 83
BtsI GCAGTG 1 cut(s) 141
BtsIMutI CAGTG 1 cut(s) 141
Cfr10I RCCGGY 1 cut(s) 49
CspAI ACCGGT 1 cut(s) 49
CviJI RGCY 3 cut(s) 8, 61, 143
CviKI_1 RGCY 3 cut(s) 8, 61, 143
DdeI CTNAG 1 cut(s) 144
Eco31I GGTCTC 1 cut(s) 40
FaiI YATR 2 cut(s) 35, 105
Fnu4HI GCNGC 1 cut(s) 72
Fsp4HI GCNGC 1 cut(s) 72
GluI GCNGC 1 cut(s) 72
HapII CCGG 2 cut(s) 26, 50
HpaII CCGG 2 cut(s) 26, 50
Hpy166II GTNNAC 1 cut(s) 94
Hpy188I TCNGA 1 cut(s) 87
Hpy8I GTNNAC 1 cut(s) 94
HpyAV CCTTC 1 cut(s) 82
HpyCH4V TGCA 3 cut(s) 71, 125, 134
HpyF10VI GCNNNNNNNGC 2 cut(s) 131, 140
HpyF3I CTNAG 1 cut(s) 144
LmnI GCTCC 1 cut(s) 58
LpnPI CCDG 2 cut(s) 39, 63
Lsp1109I GCAGC 1 cut(s) 83
LweI GCATC 1 cut(s) 58
MboII GAAGA 1 cut(s) 126
MnlI CCTC 1 cut(s) 139
MseI TTAA 2 cut(s) 54, 63
MspI CCGG 2 cut(s) 26, 50
MwoI GCNNNNNNNGC 2 cut(s) 131, 140
NmeAIII GCCGAG 1 cut(s) 69
PinAI ACCGGT 1 cut(s) 49
PkrI GCNGC 1 cut(s) 73
SaqAI TTAA 2 cut(s) 54, 63
SatI GCNGC 1 cut(s) 72
SetI ASST 3 cut(s) 63, 93, 123
SfaNI GCATC 1 cut(s) 58
SgeI CNNG 6 cut(s) 38, 57, 62, 109, 123, 134
TaqI TCGA 1 cut(s) 112
Tru1I TTAA 2 cut(s) 54, 63
Tru9I TTAA 2 cut(s) 54, 63
TscAI CASTG 1 cut(s) 141
TseI GCWGC 1 cut(s) 71
TspRI CASTG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.