Rmu_sc0039714.1_g000001

Short calmodulin-binding motif containing conserved Ile and Gln residues.

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0039714.1
OG0000760
Physical Location & Seq
Reverse (-)
1 .. 376
376 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0039714.1_g000001.1.cds

Sequence Viewer

Length: 194 bp
atgtctttctccaatgttgagtctaaccagttggatggtggccttaacaatgctctgtctgaaccagcaatcttgtttttgcctagactggttagagagcttgatgctgcagcagtcaaaattcaaaaggtttacaagagttatcgaactcgaagaaaccttgcagattgtgcagtggtggctgaggagctatg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.11

Weight (kDa)

6.15

Isoelectric Point (pI)

42.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 120
AgsI TTSAA 1 cut(s) 125
AluBI AGCT 2 cut(s) 100, 190
AluI AGCT 2 cut(s) 100, 190
AoxI GGCC 1 cut(s) 40
ApeKI GCWGC 2 cut(s) 107, 110
ApoI RAATTY 1 cut(s) 120
BbvCI CCTCAGC 1 cut(s) 183
BbvI GCAGC 2 cut(s) 94, 122
BccI CCATC 1 cut(s) 29
BfaI CTAG 1 cut(s) 84
BfmI CTRYAG 1 cut(s) 108
BisI GCNGC 2 cut(s) 108, 111
BlsI GCNGC 2 cut(s) 109, 112
BmsI GCATC 1 cut(s) 94
Bpu10I CCTNAGC 1 cut(s) 183
Bse1I ACTGG 2 cut(s) 28, 93
BseGI GGATG 1 cut(s) 40
BseMII CTCAG 1 cut(s) 174
BseNI ACTGG 2 cut(s) 28, 93
BseXI GCAGC 2 cut(s) 94, 122
BsgI GTGCAG 1 cut(s) 192
BshFI GGCC 1 cut(s) 42
BsnI GGCC 1 cut(s) 42
BspANI GGCC 1 cut(s) 42
BspCNI CTCAG 1 cut(s) 175
BspMAI CTGCAG 1 cut(s) 112
BsrI ACTGG 2 cut(s) 28, 93
BstAPI GCANNNNNTGC 1 cut(s) 170
BstDEI CTNAG 1 cut(s) 183
BstF5I GGATG 1 cut(s) 40
BstMWI GCNNNNNNNGC 2 cut(s) 170, 179
BstSFI CTRYAG 1 cut(s) 108
BstV1I GCAGC 2 cut(s) 94, 122
BstXI CCANNNNNNTGG 1 cut(s) 35
BsuRI GGCC 1 cut(s) 42
BtsCI GGATG 1 cut(s) 40
BtsI GCAGTG 1 cut(s) 180
BtsIMutI CAGTG 1 cut(s) 180
CviJI RGCY 4 cut(s) 42, 100, 182, 190
CviKI_1 RGCY 4 cut(s) 42, 100, 182, 190
DdeI CTNAG 1 cut(s) 183
FaiI YATR 1 cut(s) 193
Fnu4HI GCNGC 2 cut(s) 108, 111
FokI GGATG 1 cut(s) 47
Fsp4HI GCNGC 2 cut(s) 108, 111
FspBI CTAG 1 cut(s) 84
GluI GCNGC 2 cut(s) 108, 111
HaeIII GGCC 1 cut(s) 42
HinfI GANTC 1 cut(s) 20
Hpy166II GTNNAC 1 cut(s) 133
Hpy188I TCNGA 1 cut(s) 61
Hpy8I GTNNAC 1 cut(s) 133
HpyCH4V TGCA 3 cut(s) 110, 164, 173
HpyF10VI GCNNNNNNNGC 2 cut(s) 170, 179
HpyF3I CTNAG 1 cut(s) 183
LmnI GCTCC 1 cut(s) 187
LpnPI CCDG 3 cut(s) 41, 74, 78
Lsp1109I GCAGC 2 cut(s) 94, 122
LweI GCATC 1 cut(s) 94
MaeI CTAG 1 cut(s) 84
MboII GAAGA 1 cut(s) 165
MluCI AATT 1 cut(s) 120
MlyI GAGTC 1 cut(s) 29
MmeI TCCRAC 1 cut(s) 12
MnlI CCTC 1 cut(s) 178
MseI TTAA 1 cut(s) 45
MwoI GCNNNNNNNGC 2 cut(s) 170, 179
PkrI GCNGC 2 cut(s) 109, 112
PleI GAGTC 1 cut(s) 28
PpsI GAGTC 1 cut(s) 28
PstI CTGCAG 1 cut(s) 112
SaqAI TTAA 1 cut(s) 45
SatI GCNGC 2 cut(s) 108, 111
SchI GAGTC 1 cut(s) 29
SetI ASST 4 cut(s) 102, 132, 162, 192
SfaNI GCATC 1 cut(s) 94
SfcI CTRYAG 1 cut(s) 108
SgeI CNNG 9 cut(s) 40, 77, 85, 96, 101, 113, 148, 162, 173
Sse9I AATT 1 cut(s) 120
SspMI CTAG 1 cut(s) 84
TaqI TCGA 2 cut(s) 145, 151
TasI AATT 1 cut(s) 120
Tru1I TTAA 1 cut(s) 45
Tru9I TTAA 1 cut(s) 45
TscAI CASTG 1 cut(s) 180
TseI GCWGC 2 cut(s) 107, 110
TspRI CASTG 1 cut(s) 180
XapI RAATTY 1 cut(s) 120
XcmI CCANNNNNNNNNTGG 1 cut(s) 35
XspI CTAG 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.