RchiOBHm_Chr4g0393091

Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
8608327 .. 8611500
3174 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 366 bp
ATGCTGAGATTAGACTGGTATAATCTAGGTGGTTTTCAGGTAGGAGGTGGGATCAATTCAGATAATTCTTTGCAATACATAGAAGAAGGGGCTACCCACGTCATTGTCACTTTTTATGTATTTAATAATGGGCAAAACCTTGAAAGGCTTAAAGATCTTGTTCGTGTTGTTGGAAAAGAAAGGCTTGTTTTAGACCTTAGCTATAGAAAGAGGGAAGGTAAATATGCAATTGTCACATATAGATGGCAAAAGTTCAGTGACGTGTATCTTGACAAGGAAATATTAGACTTCCTTGCCAAGTATGCAGACGAGTTTCTGGTACATGGTGTTGATGTGGAAGGGAAAAAATCACTATCTTCTCTTTGA

Protein Analysis

121

Amino Acids

13.99

Weight (kDa)

6.1

Isoelectric Point (pI)

24.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
His_biosynth PF00977 12 - 117 1.3e-09 Histidine biosynthesis protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 59
AfaI GTAC 1 cut(s) 321
AflIII ACRYGT 1 cut(s) 261
AgsI TTSAA 1 cut(s) 143
AjiI CACGTC 2 cut(s) 100, 262
AluBI AGCT 1 cut(s) 201
AluI AGCT 1 cut(s) 201
AlwI GGATC 1 cut(s) 59
BccI CCATC 1 cut(s) 237
BfaI CTAG 1 cut(s) 26
BfmI CTRYAG 1 cut(s) 202
BglII AGATCT 1 cut(s) 154
BmgBI CACGTC 2 cut(s) 100, 262
Bpu10I CCTNAGC 1 cut(s) 197
Bse1I ACTGG 1 cut(s) 20
BseNI ACTGG 1 cut(s) 20
Bsp143I GATC 2 cut(s) 51, 154
BspPI GGATC 1 cut(s) 59
BsrI ACTGG 1 cut(s) 20
BssMI GATC 2 cut(s) 51, 154
BstDEI CTNAG 2 cut(s) 5, 197
BstKTI GATC 2 cut(s) 54, 157
BstMBI GATC 2 cut(s) 51, 154
BstMWI GCNNNNNNNGC 1 cut(s) 302
BstSFI CTRYAG 1 cut(s) 202
BstX2I RGATCY 1 cut(s) 154
BstYI RGATCY 1 cut(s) 154
BtrI CACGTC 2 cut(s) 100, 262
BtsIMutI CAGTG 1 cut(s) 262
Csp6I GTAC 1 cut(s) 320
CviAII CATG 1 cut(s) 323
CviJI RGCY 4 cut(s) 92, 148, 184, 201
CviKI_1 RGCY 4 cut(s) 92, 148, 184, 201
CviQI GTAC 1 cut(s) 320
DdeI CTNAG 2 cut(s) 5, 197
DpnI GATC 2 cut(s) 53, 156
DpnII GATC 2 cut(s) 51, 154
FaeI CATG 1 cut(s) 326
FaiI YATR 9 cut(s) 21, 80, 117, 204, 225, 238, 240, 303, 324
FalI AAGNNNNNCTT 2 cut(s) 168, 200
FatI CATG 1 cut(s) 322
FspBI CTAG 1 cut(s) 26
Hin1II CATG 1 cut(s) 326
Hpy188I TCNGA 1 cut(s) 61
Hpy188III TCNNGA 1 cut(s) 269
HpyAV CCTTC 3 cut(s) 80, 209, 332
HpyCH4IV ACGT 2 cut(s) 99, 261
HpyCH4V TGCA 3 cut(s) 73, 227, 305
HpyF10VI GCNNNNNNNGC 1 cut(s) 302
HpyF3I CTNAG 2 cut(s) 5, 197
HpySE526I ACGT 2 cut(s) 99, 261
Hsp92II CATG 1 cut(s) 326
Kzo9I GATC 2 cut(s) 51, 154
LpnPI CCDG 2 cut(s) 23, 302
MaeI CTAG 1 cut(s) 26
MaeII ACGT 2 cut(s) 99, 261
MaeIII GTNAC 3 cut(s) 106, 232, 257
MalI GATC 2 cut(s) 53, 156
MboI GATC 2 cut(s) 51, 154
MboII GAAGA 2 cut(s) 95, 348
MfeI CAATTG 1 cut(s) 228
MflI RGATCY 1 cut(s) 154
MluCI AATT 3 cut(s) 55, 64, 228
MmeI TCCRAC 1 cut(s) 151
MnlI CCTC 2 cut(s) 38, 204
MseI TTAA 2 cut(s) 123, 150
MslI CAYNNNNRTG 1 cut(s) 241
MunI CAATTG 1 cut(s) 228
MwoI GCNNNNNNNGC 1 cut(s) 302
NdeII GATC 2 cut(s) 51, 154
NlaIII CATG 1 cut(s) 326
NmuCI GTSAC 3 cut(s) 106, 232, 257
PsuI RGATCY 1 cut(s) 154
RsaI GTAC 1 cut(s) 321
RsaNI GTAC 1 cut(s) 320
RseI CAYNNNNRTG 1 cut(s) 241
SaqAI TTAA 2 cut(s) 123, 150
Sau3AI GATC 2 cut(s) 51, 154
SetI ASST 9 cut(s) 31, 42, 49, 102, 141, 198, 203, 220, 264
SfcI CTRYAG 1 cut(s) 202
SmiMI CAYNNNNRTG 1 cut(s) 241
Sse9I AATT 3 cut(s) 55, 64, 228
SspI AATATT 1 cut(s) 282
SspMI CTAG 1 cut(s) 26
TaiI ACGT 2 cut(s) 102, 264
TasI AATT 3 cut(s) 55, 64, 228
Tru1I TTAA 2 cut(s) 123, 150
Tru9I TTAA 2 cut(s) 123, 150
TscAI CASTG 1 cut(s) 262
TseFI GTSAC 3 cut(s) 106, 232, 257
Tsp45I GTSAC 3 cut(s) 106, 232, 257
TspRI CASTG 1 cut(s) 262
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.